Spring 2019 ORFan Gene Project Pre-Test

Spring 2019 ORFan Gene Project Pre-Test

Thank you for participating in the ORFan Gene Project Assessment. Participation in this pre-test is completely voluntary. Your individual score will be kept confidential, and will not be revealed to your instructor. Furthermore, your performance will not be used as part of your grade for the course in which this assessment is being administered. The ORFan Gene Project will use aggregate data from this assessment instrument in order to determine the effectiveness of our work as a whole, to make improvements going forward, and to publish our findings. Thus, your participation is incredibly important to our work, and we thank you again, in advance. If you have any questions or concerns, please contact Jill Keeney at Keeney@juniata.edu.

Please answer each question below to the best of your ability. Since we are assessing your knowledge, rather than your guessing ability, please do use answer (e) "I do not have the knowledge base to answer this question" if that is true.

Academic Institution *

Your answer

ID Number: Your unique identifier will be the following nine digits: Your birth month (xx) birth day (xx) and zip code (XXXXX). So, if you were born on June 19 and your zipcode is 16666, your ID would be 061916666. *

Your answer

Demographics (optional)

Please indicate your gender

Female

Male

Prefer not to say

Other

Please indicate your Ethnicity origin (or Race): Please specify your ethnicity, checking as many as apply.

White

Hispanic or Latino

Black or African American

Native American or American Indian

Asian/Pacific Islander

Prefer not to answer

Other:

I Certify that I am at least 18 years old *

Column 1

Yes

Knowledge and Skills Questions

Which of the following is NOT a gene ontology domain? *

molecular function

cellular function

biological function

biological process

I do not have the knowledge base to answer this question

Which of the following best qualifies as a molecular function? *

kinase activity

microtubule

glucolysis

ion transport

I do not have the knowledge base to answer this question

A(n)_____ ORF is likely to encode an expressed protein, but there is a lack of specific experimental data demonstrating protein production. *

verified

dubious

paralogous

uncharacterized

I do not have the knowledge base to answer this question

A gene of unknown function (ORFan) is best defined as a gene for which: *

one or more GO terms are annotated as unknown

there is no evidence for protein production

a homolog exists in another species

there are overlapping genes on the opposite strand

I do not have the knowledge base to answer this question

Is this statement true? "The ORFs of unknown function in yeast are easily identified as such ORFs only have a systematic name (e.g. - YFL039C) and no standard name (e.g. – ACT1)" *

yes, because ORFs are only given a standard name once their function is known

yes, because ORFs with only systematic names have no known GO terms

no, because all annotated ORFs have a systematic name and genes can be given standard names based on screens or other results, before function is known

no, because annotated ORFs only have a standard name until they are given a systematic name

I do not have the knowledge base to answer this question

Which of the following is best suited to comparing protein sequences? *

SPELL

SWISS-PROT

BLAST-P

BLAST-N

I do not have the knowledge base to answer this question

Which of the following sequences is best suited for BLAST-N? *

TCAGTTAATCTCAGTCACAA

MSDENKSTPIVKASDITDKL

either a or b

neither a nor b

I do not have the knowledge base to answer this question

Which of the following tools would you use to determine the transcription expression profile for an ORF? *

Pfam

SPELL

CYCLoPs

BioGRID

I do not have the knowledge base to answer this question

YLR042 is a verified ORF of interest. SGD description reads: "Cell wall protein of unknown function; localizes to the cytoplasm; deletion improves xylose fermentation in industrially engineered strains; YLR042C is not an essential gene" (Note: xylose is a sugar). Which of the following tools would be best to use to investigate the discrepancy in the description that states this protein is a cell wall protein and that it is located in the cytoplasm? *

(TMHMM) Transmembrane Helices Hidden Markov Models

PSORTII

YeastGFP (yeast protein localization database)

Saccharomyces cerevisiae Morphological Database (SCMD)

I do not have the knowledge base to answer this question

After subjecting the sequence for your favorite protein to a database search, you are provided with several related proteins. With respect to the e-values for the related proteins, which of the following is most likely to be true? *

When the e-value equals 1, the protein has been matched to itself

When the e-value equals 0, there is no similarity between the two proteins being compared

A match with an e-value of 1e-107 is less similar to your favorite protein than a match with an e-value of 3e-156

All of the above are true

I do not have the knowledge base to answer this question

You have received the aligned sequences for two proteins. Which of the following would be evidence that they could share a similar function? *

They have 85% percent amino acid identity

They have a lower percent amino acid identity, but 75% of the aligned amino acids have similar chemical features

They have 52% amino acid identity, but their predicted protein structures (e.g. secondary, tertiary) are similar

They have 52% amino acid identity, but their predicted protein structures (e.g. secondary, tertiary) are similar

I do not have the knowledge base to answer this question

Which of the following is the most general term used to describe evolutionarily related genes? *

Homolog

Ortholog

Paralog

Analog

I do not have the knowledge base to answer this question

if an ORF of unknown function has homology only to genes in other yeast species, is this gene of interest to scientists? *

no, because the gene is only in yeasts, so it would not be applicable to medicine

yes, because knowledge of the gene could be useful for brewing or pharmaceuticals

yes, because it may have structural homology to genes in larger eukaryotes

both b and c are reasonable responses

I do not have the knowledge base to answer this question

Research Skills Questions

Please look over this inventory of elements that might be included in a course. For each element, give an estimate of your current level of ability. Please use this scale: mark a "1" if you have no experience or you feel inexperienced, mark a "2" if you have some experience, or mark a "3" if you have much experience or feel you have mastered this element. Your current level of ability may be a result of courses in high school or college, or it may be a result of other experiences such as jobs or special programs. *

1 - no experience or feel inexperienced

2 - some experience

3 - much experience or mastered this element

N.A.

A lab or project where no one knows the outcome

A project in which students have some input into the research process and/or what is being studied

A project entirely of student design

Become responsible for a part of the project

Read primary scientific literature

Collect data

Analyze data

Present results (orally, written papers or reports, posters)

Computer modeling

1 - no experience or feel inexperienced

2 - some experience

3 - much experience or mastered this element

N.A.

A lab or project where no one knows the outcome

A project in which students have some input into the research process and/or what is being studied

A project entirely of student design

Become responsible for a part of the project

Read primary scientific literature

Collect data

Analyze data

Present results (orally, written papers or reports, posters)

Computer modeling

Submit

Never submit passwords through Google Forms.

This content is neither created nor endorsed by Google. Report Abuse - Terms of Service