Juniata HHMI Core GCAT-SEEK Concepts Pretest, 2013-2014

Welcome to the GCAT-SEEK Pre-Course Assessment Instrument for Core GCAT SEEK concepts! Please answer each of these questions to the best of your ability. We realize that many of these concepts will be new to you, so just do the best that you can. By then end of your course/research experience, we expect that these ideas will be much more familiar.
    This is a required question

    Core Next Generation Sequencing Concepts

    Answer the following questions that are common to all GCAT-SEEK instruments.
    This is a required question
    This is a required question
    This is a required question
    Species  1: GACATTGATCTGGGAAACTAGCT
    Species  2: GACATTGATCTTGGAAACTAGCT
    Species  3: GACATTGATCTTGTTAACTAGCT
    Species  4: GACATTGATCTTTTTTTCTAGCT
    This is a required question
    This is a required question
    This is a required question

    Essay

    This is a required question