Published using Google Docs
The Terrain is everything, changing the current Paradigm
Updated automatically every 5 minutes

Scripture

God’s plan for man’s salvation

https://docs.google.com/document/d/e/2PACX-1vS4YfKm5L3cbXUbVQwkxBAio4aWC5q6ay5tsFMG5a3aLlwsRAmLWMzXiIiZ9lS_zLEWJwoIZx9aK_Gf/pub

Matthew 7:7 “Ask, and it will be given to you; seek, and you will find; knock, and it will be opened to you.

Proverbs 1:7 The fear of the LORD is the beginning of knowledge; fools despise wisdom and instruction.

James 1:5-8 If any of you lacks wisdom, let him ask of God, who gives to all liberally and without reproach, and it will be given to him. But let him ask in faith, with no doubting, for he who doubts is like a wave of the sea driven and tossed by the wind. For let not that man suppose that he will receive anything from the Lord; he is a double-minded man, unstable in all his ways.

Matthew 28:19-20 Go therefore and make disciples of all nations, baptizing them in the name of the Father and of the Son and of the Holy Spirit, teaching them to observe all that I have commanded you. And behold, I am with you always, to the end of the age.”

Luke 16:31 “But Abraham said, ‘If they won’t listen to Moses and the prophets, they won’t be persuaded even if someone rises from the dead.’”

John 8:47 Whoever is of God hears the words of God. The reason why you do not hear them is that you are not of God.”

Cognitive dissonance

Why it’s hard to forget what you have learned

https://www.facebook.com/DrChristianeNorthrup/videos/620754822104138/?t=31

The Harsh Truth - Why So Many Refuse To See It

https://www.youtube.com/watch?v=vIH9neolGUw 

Why We Stay Asleep When Covid-19 Is Trying to Wake Us Up Dr. Kelly Brogan

https://kellybroganmd.com/why-we-stay-asleep-when-covid-19-is-trying-to-wake-us-up/ 

Forget everything you were taught

https://i.postimg.cc/wBQcDMbw/Forget-everything-you-were-taught.jpg 

People try to suppress that which goes against their long held belief

https://i.postimg.cc/85NPkMLG/Science-truth.jpg 

This is why people get upset when their beliefs are challenged.

https://i.postimg.cc/QxrMhdvj/Cognitive-Dissonance.jpg 

J Edgar Hoover quote

https://i.postimg.cc/85gx6pSg/J-Edgar-Hoover-quote.jpg 

Lack of proof of covid and people still close their minds

https://i.postimg.cc/fbzWqbZM/Lack-of-proof.jpg 

No lack of proof available people just don’t want to hear the facts

https://i.postimg.cc/SQd819Qh/truth.jpg 

Appeal to common belief

https://i.postimg.cc/8kwmKD7T/Appeal-to-common-belief.jpg 

On The Psychology Of The Conspiracy Denier 3/14/21

https://off-guardian.org/2021/03/12/on-the-psychology-of-the-conspiracy-denier/ 

Why Are Intelligent People Conformist But Super-Intelligent People Non-Conformist?

https://www.youtube.com/watch?v=ueAnozqk0i4 

Scripture

Genesis 3:1-7 Now the serpent was more crafty than any beast of the field which the Lord God had made. And he said to the woman, “Indeed, has God said, ‘You shall not eat from any tree of the garden’?” The woman said to the serpent, From the fruit of the trees of the garden we may eat; but from the fruit of the tree which is in the middle of the garden, God has said, You shall not eat from it or touch it, or you will die 

Ephesians 2:12  "remember that you were at that time separate from Christ, excluded from the commonwealth of Israel, and strangers to the covenants of promise, having no hope and without God in the world."

Exodus 22:20 “He who sacrifices to any god, other than to the Lord alone, shall be utterly destroyed.

1 Thessalonians 5:6 so then let us not sleep as others do, but let us be alert and sober. 

1 John 3:10 "By this the children of God and the children of the devil are obvious: anyone who does not practice righteousness is not of God, nor the one who does not love his brother."

Behavioral priming

Hofling Hospital Experiment Charles K. Hofling (1966) created a more realistic study of obedience than Milgram’s by carrying out field studies on nurses who were unaware that they were involved in an experiment.

https://www.simplypsychology.org/hofling-obedience.html 

According to behavioral scientists who were members of the Independent Scientific Pandemic Insights Group on Behaviors (SPI-B), we have all been strategically systematically “stunned by the weaponization of behavioral psychology” throughout the pandemic.

https://degraw.substack.com/p/follow-the-science-on-psyops-to-understand 

What if we’ve all been primed?

https://tomnikkola.com/prime/ 

Genesis & development of a scientific fact. People believe what they are told to believe.  Rarely do we go back to the source and ask "how do we really KNOW that?"

https://books.google.com/books?hl=en&lr&id=MHfRAgAAQBAJ&oi=fnd&pg=PR5&ots=kwOuDVIK4p&sig=19yd225GjgPMi6Q79KK3Aa8D9PY 

The pandemic pattern, how the illusion is built 8/13/20

https://blog.nomorefakenews.com/2020/08/13/the-pandemic-pattern-how-illusion-is-built/

How the "Greater Good" is Used as a Tool of Social Control

https://www.youtube.com/watch?v=gvPKTVK10JE&feature=youtu.be 

One of the hallmarks of totalitarianism is mass conformity to a psychotic official narrative. 11/18/20

https://consentfactory.org/2020/10/13/the-covidian-cult/ 

They’re lying to us, here is exactly how they do it. 8/14/20

https://thepragmaticconstitutionalist.com/2020/08/theyre-lying-to-us-heres-exactly-how-they-do-it/

How to Brainwash 7 billion people

https://www.youtube.com/watch?v=HIuhjV8CXhs 

We are living in a country of lies. A country where propaganda is disseminated around the clock and lies are the air we breathe. Is it any wonder that most people are confused as to what to believe and whom to trust? But it goes much deeper. 10/2/20

https://www.globalresearch.ca/powerful-obnoxious.../5725447

“Repeat a lie often enough and it becomes the truth”, is a law of propaganda often attributed to the Nazi Joseph Goebbels. Among psychologists something like this known as the "illusion of truth" effect.

https://www.bbc.com/future/article/20161026-how-liars-create-the-illusion-of-truth 

The Politics of Obedience: The Discourse of Voluntary Servitude

https://mises.org/library/politics-obedience-discourse-voluntary-servitude

Why are critical thinking skills lacking in society? 10/12/20

http://journalisticrevolution.com/covid1984-a-plandemic-love-story-part-2#Critical_Thinking 

Surviving Mind Control & Gaslighting Henna Maria 10/12/20

https://www.youtube.com/watch?v=5woYwwg7lHo&feature=youtu.be 

This conditioning is deeply personal and deeply seated in the minds of people who have been trudging along the bleak path of medical care since early childhood. 10/28/20

https://blog.nomorefakenews.com/2020/10/28/the-virus-story-breaking-the-chains-of-medical-civilization/ 

Biderman’s chart of coercion

https://i.postimg.cc/NFSnHb1B/Bidermans-chart-of-coercion.jpg 

One cannot change reality by changing the words you use to describe reality. Look beneath the rhetoric, and glimpse the truth.

https://www.youtube.com/watch?v=vb8Rj5xkDPk

People gravitate to single causes, single explanations, single symbols in every area of life, and they don’t penetrate further. 12/28/20

https://blog.nomorefakenews.com/2020/12/26/revealed-matrix-the-monolith-how-i-put-together/

Michael Hoffman | The Alchemical Processing of Humanity Through Public Psychodrama

https://www.youtube.com/watch?v=vqFcp3jaPGk 

Transcript-The-Alchemical-Processing-of-Humanity-Through-Public-Psychodrama 1/2/21

http://gunsandbutter.org/transcript-the-alchemical-processing-of-humanity-through-public-psychodrama.htm

15 Common Logical Fallacies and How to Spot Them

https://blog.hubspot.com/marketing/common-logical-fallacies 

Why Do Americans Need and Seek Masters to Rule Them? 3/12/21

https://www.garydbarnett.com/why-do-americans-need-and-seek-masters-to-rule-them 

Why is it that otherwise perfectly intelligent, thoughtful and rationally minded people baulk at the suggestion that sociopaths are conspiring to manipulate and deceive them? And why will they defend this ill-founded position with such vehemence? 3/26/21

https://reportingforbeauty.substack.com/p/on-the-psychology-of-the-conspiracy-7ff 

Voltaire on Capitol Hill: ‘Anyone who can make you believe absurdities can make you commit atrocities’

https://voltairefoundation.wordpress.com/2021/02/16/voltaire-on-capitol-hill-anyone-who-can-make-you-believe-absurdities-can-make-you-commit-atrocities/ 

Controlled Opposition In The Truth Movement

https://www.natureofhealing.org/controlled-opposition-truth-movement/ 

These videos by Nigel Howitt And please also understand that it's ok to be wrong about things.To truly discover you're wrong is actually the best thing that can happen since it means you gained true knowledge.

https://youtu.be/Pjx98Vw8c5k

https://youtu.be/r4h9ud9eYfA

Lifton's Thought Reform

https://culteducation.com/brainwashing/26424-thought-reform-and-the-psychology-of-totalism.html 

http://changingminds.org/techniques/conversion/lifton_thought_reform.htm?

MASS PSYCHOSIS - How an Entire Population Becomes MENTALLY ILL 8/5/21

https://www.youtube.com/watch?v=09maaUaRT4M 

Covidnosis: How Empire Brainwashed the World 8/26/21

https://freeworldnews.tv/watch?id=6126b22a0b825c6c22e07be1 

Scripture

2 Corinthians 4:4 Satan, who is the god of this world, has blinded the minds of those who don’t believe. They are unable to see the glorious light of the Good News. They don’t understand this message about the glory of Christ, who is the exact likeness of God.

Revelation 17:13-14 These are of one mind, and they hand over their power and authority to the beast. They will make war on the Lamb, and the Lamb will conquer them, for he is Lord of lords and King of kings, and those with him are called and chosen and faithful.”

Psalm 118:8-9 It is better to take refuge in the Lord than to trust in man. It is better to take refuge in the Lord than to trust in princes.

1 John 4:1 Beloved, do not believe every spirit, but test the spirits to see whether they are from God, for many false prophets have gone out into the world.

Philippians 1:28 "in no way alarmed by your opponents--which is a sign of destruction for them, but of salvation for you, and that too, from God."

Romans 1:28-32 And just as they did not see fit to acknowledge God, God gave them up to a depraved mind, to do those things that are not proper, people having been filled with all unrighteousness, wickedness, greed, and evil; full of envy, murder, strife, deceit, and malice; they are gossips, slanderers, haters of God, insolent, arrogant, boastful, inventors of evil, disobedient to parents, without understanding, untrustworthy, unfeeling, and unmerciful; and although they know the ordinance of God, that those who practice such things are worthy of death, they not only do the same, but also approve of those who practice them.

Colossians 2:8 "Beware lest any man spoil you through philosophy and vain deceit, after the tradition of men, after the rudiments of the world, and not after Christ." 

Psalm 2 Why are the nations restless And the peoples plotting in vain? The kings of the earth take their stand And the rulers conspire together Against the Lord and against His Anointed, saying,  “Let’s tear their shackles apart And throw their ropes away from us!” He who sits in the heavens laughs, The Lord scoffs at them. Then He will speak to them in His anger And terrify them in His fury, saying, “But as for Me, I have installed My King Upon Zion, My holy mountain.”  “I will announce the decree of the Lord: He said to Me, ‘You are My Son, Today I have fathered You. Ask it of Me, and I will certainly give the nations as Your inheritance, And the ends of the earth as Your possession. You shall break them with a rod of iron, You shall shatter them like earthenware.’” Now then, you kings, use insight; Let yourselves be instructed, you judges of the earth. Serve the Lord with reverence And rejoice with trembling. Kiss the Son, that He not be angry and you perish on the way, For His wrath may be kindled quickly. How blessed are all who take refuge in Him!

Is Klaus Schwab the Most Dangerous Man in the World?

https://www.youtube.com/watch?v=6G3nWyoQ5CQ 

Who is behind the plandemic?

In January 2020, well before the coronavirus (Covid-19) crisis would result in lockdowns, quarantines and economic devastation in the United States and beyond, the U.S. intelligence community and the Pentagon were working with the National Security Council to create still-classified plans to respond to an imminent pandemic. It has since been alleged that the intelligence and military intelligence communities knew about a likely pandemic in the United States as early as last November, and potentially even before then.

https://www.thelastamericanvagabond.com/coronavirus-gives-dangerous-boost-darpas-darkest-agenda/ 

Global Collusion and Global Conspiracy Equal Global Tyranny 12/16/21

https://www.garydbarnett.com/global-collusion-and-global-conspiracy-equal-global-tyranny/

BILDENBURG Group is no doubt planning and implementing a world wide agenda to control the direction of the earth's future Organizers included Prince Bernhard of the Netherlands, Henry Kissinger, Lord Rothschild and Laurance Rockefeller. They selected 100 of the world's most influential people, many from other secretive organizations such as the Council on Foreign Relations, and the Trilateral Commission. Their first goal was to organize Europe. It is believed that the Bilderberg Group gave birth to the European Community now known as the European Union. One World Government or the New World Order, appears to be their ultimate goal.

https://www.higherpraise.com/NewWorldOrder.htm 

http://www.bilderberg.org/bilder.htm#What

The NWO plan all laid out on their website. Go Step by step through the website

https://www.gracevanberkum.com/post/we-are-being-played-please-read

From the UN and WHO see Pages 10-12

https://apps.who.int/gpmb/assets/annual_report/GPMB_annualreport_2019.pdf 

Going Direct Reset 12/20/21

https://twitter.com/GeniePaddy/status/1472601087945420805 

Rockefeller medicine men : medicine and capitalism in America

https://archive.org/details/rockefellermedic00browrich 

April 9, 2020: World Economic Forum website: "we are conducting arguably the largest #psychological experiment ever"

https://threadreaderapp.com/thread/1353557866834255879.html 

Russia Joins Centre for the Fourth Industrial Revolution Network 2/26/22

https://www.weforum.org/press/2021/10/russia-joins-centre-for-the-fourth-industrial-revolution-network 

While much of the “mainstream” world has spent the last few days obsessing over and debating the celebrity spectacle surrounding American actor Will Smith slapping American comedian Chris Rock, the international elitists were meeting in Dubai for the 2022 World Government Summit. 4/1/22

https://www.thelastamericanvagabond.com/while-you-were-distracted-by-will-smith-the-international-elite-met-at-the-world-government-summit 

2013 Rockefeller Paper Predicted Isolation, the Death of Physical Interaction & Global Health Police

https://geopolitics.co/2021/03/21/2013-rockefeller-paper-predicted-isolation-the-death-of-physical-interaction-global-health-police 

CV Pandemic was predicted 30 years ago

https://www.youtube.com/watch?v=Wr9IdY_zA-M&feature=youtu.be

Proof pandemic was planned with a purpose 9/29/20

https://www.stopworldcontrol.com/planned/ 

The “pandemic” is really a plan-demic which has been in the works for years. 10/29/20

https://brendandmurphy.com/100-proof-covid-19-was-planned-years-in-advance-truthiverse-episode-14-with-brendan-d-murphy/ 

A closer look at the Live “Training & Simulation Exercise” under WHO that preceded the plandemic in October 2019

https://envirowatchrangitikei.wordpress.com/2020/08/09/a-closer-look-at-the-live-training-simulation-exercise-under-who-that-preceded-the-plandemic-in-october-2019/

Melbourne Hiring actors to ‘play people affected by lock down’ in a storyline of how they are coping throughout this ‘Plandemic’.

https://australiannationalreview.com/state-of-affairs/adverts-for-crisis-actors-in-melbourne-to-sell-the-lie-that-is-covid/

It makes sense that covid-19 was pre-planned, here's why

https://www.discerningreality.com/post/it-makes-sense-that-covid-19-was-pre-planned-here-s-why 

Where we are heading and the planned agenda 9/26/20

https://steemit.com/politics/@johnblaid/where-we-are-heading-and-the-planned-agenda

World Bank document lists covid 19 ending 2025 9/10/20

https://nationalfile.com/world-bank-document-lists-covid-19-program-ending-in-march-2025 

COVID19: The Simulated Pandemic Planned By World Governments

https://principia-scientific.com/covid19-the-simulated-pandemic-planned-by-world-governments 

The true agenda, a New World Order 

https://vigilantcitizen.com/latestnews/the-true-agenda-of-the-who-a-new-world-order-modeled-after-china/

Meet the Israeli Intelligence-Linked Firm Using AI to Profile Americans and Guide US Lockdown Policy

https://www.thelastamericanvagabond.com/health/meet-israeli-intelligence-linked-firm-using-ai-profile-americans-guide-us-lockdown-policy/

THE ENTIRE ROCKEFELLER EUGENICS COVID-19 PLAN EXPOSED - PRESIDENT OF GHANA (VIDEO)

https://www.bitchute.com/video/RaYsgpGVGblY/

Roy Fields shows you how they planned this all out. (It’s in the money!)

https://www.metatube.com/en/videos/464472/Roy-Fields-shows-you-how-they-planned-this-all-out-It-s-in-the-money/ 

CORONA PLANDEMIC FOR GLOBAL GOVERNANCE (SHORTENED VIDEO) 2/1/21

https://www.bitchute.com/video/hVzg8LpUvKhC 

COVID-19 In Context: Subversion, Psychological Warfare, and New World Order

https://coronacircus.com/2020/03/31/covid-19-in-context-subversion-psychological-warfare-and-new-world-order/

Rockefeller Foundation Paper Revealed Plan to Exploit Pandemic

https://thefreedomarticles.com/2010-rockefeller-foundation-paper-plan-exploit-pandemic/

Exercise Cygnus uncovered: the pandemic warnings buried by the government

https://www.telegraph.co.uk/news/2020/03/28/exercise-cygnus-uncovered-pandemic-warnings-buried-government/

COVID-19: The Great Reset | World Economic Forum

https://www.weforum.org/agenda/2020/07/covid-19-the-great-reset/

World Economic Forum's own online “Wheel of Strategic Intelligence”

https://intelligence.weforum.org/topics/a1G0X000006O6EHUA0?tab=publications

Rockefeller Foundation document from 10 years ago, outlining the "Lockstep" plan without falling into the obvious traps laid out in regards to misinformation 8/31/20

https://www.bitchute.com/video/Xsus7i6CikE/ 

Spars pandemic 2025-2028

https://www.centerforhealthsecurity.org/our-work/pubs_archive/pubs-pdfs/2017/spars-pandemic-scenario.pdf

Origin of the war against the population of Earth, pretense of containing the virus

https://blog.nomorefakenews.com/2020/08/12/the-china-lockdown-origin-of-the-war-against-the-population-of-earth-pretense-of-containing-the-virus/

The complete explanation of the Plan-demic, which was indeed planned by the United Nations World Health Organization, and signed onto by the Municipal Governments of 196 countries.

https://www.curezone.org/blogs/fm.asp?i=2431673

They've Planned This For Years - COVID-1984 8/26/20

https://www.greenmedinfo.com/blog/theyve-planned-years-covid-1984

The COVID19 Scamdemic – Part 1 8/28/20

https://off-guardian.org/2020/08/28/the-covid19-scamdemic-part-1/ 

HOW & WHY A WORLDWIDE "VIRUS" HOAX IS POSSIBLE 10/1/20

https://thebigvirushoax.com/how-%26-why-a-global-hoax 

It was destined to happen this way

https://www.youtube.com/watch?v=ebiUd-Wb6NM&feature=youtu.be

It is a man-made disaster. Subtitles ACU Prof Franz Ruppert 8/24/20

https://www.youtube.com/watch?v=QS8SPk_5k7c&feature=youtu.be

Take the time to watch this in its entirety, critically think & do more research, you will be left with some big changes to make in how you think, what you believe and how you will move forward.

https://unmaskeddocumentary.com/

Rockefeller Lockstep Plan

https://i.postimg.cc/htNc3ryf/Rockefeller-Lockstep.jpg

Rockefeller Lockstep Plan 2

https://i.postimg.cc/MGRqkQNt/Rockefeller-Lockstep-2.jpg 

The Spars pandemic scenario in the coming years.

https://www.centerforhealthsecurity.org/our-work/pubs_archive/pubs-pdfs/2017/spars-pandemic-scenario.pdf 

COVID-19 - Evidence of Fraud, Medical Malpractice, Acts of Domestic Terrorism and Breaches of Human Rights - Investigating The Alleged COVID-19 Pandemic 9/16/20

https://cvpandemicinvestigation.com/2020/09/covid-19-evidence-of-fraud-medical-malpractice-acts-of-domestic-terrorism-and-breaches-of-human-rights/

The COVID-1984 Conspiracy is a One World Order Out of Chaos Coup

https://onfireforgod.today/covid-1984-conspiracy/

Why the lockdowns

https://www.facebook.com/grahamj.carey.5/videos/671051003783390 

The great reset for dummies

https://straightlinelogic.com/2020/11/01/the-great-reset-for-dummies-by-tessa-lena/ 

Breakdown of how we are all being dragged into the 4th industrial revolution using the "virus" crisis. Biometric health passports 12/30/20

https://www.youtube.com/watch?v=7sYRF99IT3w&feature=emb_logo 

Catherine covers the spectrum of the current situation we find ourselves in. The Great Reset- Destroying the dollar 12/30/20

https://www.bitchute.com/video/GobhgzivWtV4/ 

We have psychopaths and sociopaths dressed up as politicians, public health officials, and billionaires, with egos the size of Jupiter, running the human race as hard as possible into the ground 3/10/21

https://drsircus.com/general/fascist-doctors-return-with-cruel-treatment/ 

In her 2008 book, “End of America,” Naomi Wolf outlined the 10 steps those in power use to close down democracies. Sadly, she writes today, as governments use the pandemic to justify the suppression of civil rights, America is now in the throes of “Step Ten.” 3/12/21

https://childrenshealthdefense.org/defender/naomi-wolf-steps-to-fascism 

UNITE FOR FREEMASONS - THE FAKE-AWAKE REBELLION  3/13/21

https://www.puretruth.co.uk/blog/unite-for-freemasons-the-fake-awake-rebellion 

Whitney is joined by independent journalist Cory Morningstar to discuss the 4th industrial revolution, which aims to merge the natural and digital worlds via technology and is backed by the world's most predatory billionaires and corporations. 3/15/21

https://soundcloud.com/unlimited-hangout/demystifying-the-4th-industrial-revolution-with-cory-morningstar 

The International Air Transport Association laying out agenda to use injection passports

https://www.iata.org/ 

SPARS Pandemic Scenario

https://www.centerforhealthsecurity.org/our-work/Center-projects/completed-projects/spars-pandemic-scenario.html 

Monopoly: an overview of the Great Reset. This informative video gives an overview of what is currently happening in the world in just 1 hour. The video shows the modern global systems, and focuses on the situation in the Netherlands. The City of London runs the money system, the Vatican runs religion and the law, and Washington DC runs the military. They are all independent city states and none of them have your best interests at heart - in fact, quite the opposite.

https://www.youtube.com/watch?v=D2t4u_tEefM 

Prepping for a cyber pandemic: Cyber Polygon 2021 to stage supply chain attack simulation

https://sociable.co/technology/prepping-cyber-pandemic-cyber-polygon-stage-supply-chain-attack-simulation 

Who is making #Agenda21 happen? With Rosa Koire

https://www.youtube.com/watch?v=MPwJSTTxr38 

WHO: Give Us Total Control And COVID Will Be ‘The Last Pandemic’

https://www.technocracy.news/who-give-us-total-control-and-covid-will-be-the-last-pandemic/ 

This interview with WHO whistleblower Astrid Stuckelberger provides insight into the inner workings of the organization. She worked on the International Health Regulations in multiple countries which form part of the legalese of how the pandemic was declared world wide. Listen to her perspective on how the actions of the WHO violate their own regulations.

https://rumble.com/vhyx79-astrid-stuckelberger-global-corruption-planet-lockdown.html 

Improving Science Literacy | DAVOS AGENDA 2021

https://www.youtube.com/watch?v=mOlPnOm3Ycg 

The pandemic presented forensically for what it is, namely, a massive theatrical edifice intended to distract popular attention away from the fact that criminal bankers running the monetary system are making a concerted push toward full-on totalitarianism through monetary and financial control. 8/20/21

https://www.youtube.com/watch?v=VYOEvurCVuk 

AN EVIL AGENDA BY BLOODLINE FAMILIES -- DR. CHRISTIANE NORTHRUP 8/25/21

https://www.bitchute.com/video/ZutSRWBp6v0c/ 

Dark Winter

https://www.centerforhealthsecurity.org/our-work/events-archive/2001_dark-winter/Dark%20Winter%20Script.pdf 

Social robots have many potential applications, including some we’re already seeing in the real world.

https://bigthink.com/technology-innovation/sophia-the-robot-hanson-robotics 

The Great Reset: How a ‘Managerial Revolution’ Was Plotted 80 Years Ago by a Trotskyist-turned-CIA Neocon

https://cynthiachung.substack.com/p/the-great-reset-how-a-managerial 

A Documentary revealing the connection between Covid-19 >> Vaccines >> Masks >> The Banking System and The Great Reset

https://rumble.com/vlmsmn-2030-unmasked-for-those-preparing-for-whats-coming-after-covid-19.html 

A small group of people use cunning and deceptive means to launch a biological war against billions of civilians around the world. 10/14/21

https://twitter.com/darker51146676/status/1447700510094417920?s=28& 

This brilliant documentary by Tim Gielen reveals how a small group of super rich criminals have been buying virtually everything on earth, until they own it all. From media, health care, travel, food industry, governments... That allows them to control the whole world. Because of this they are trying to impose the New World Order.

https://rumble.com/vn7lf5-monopoly-who-owns-the-world-must-see.html 

The Great Reset is the name of the 50th annual meeting of the World Economic Forum (WEF), held in June 2020.

https://www.youtube.com/watch?v=2Xwilhs6Ou8 

Ten technologies to fight coronavirus

https://www.europarl.europa.eu/RegData/etudes/IDAN/2020/641543/EPRS_IDA(2020)641543_EN.pdf 

Look to the Jesuits 4/1/22

https://www.trinityfoundation.org/Podcast/TFR%2015.The%20Jesuits%20and%20the%20Covid%20Pandemic.Audio.Final(1).mp3 

Cyber Polygon

Cyber Polygon 2020

https://2020.cyberpolygon.com/results-2020/

The international capacity building initiative aimed at raising global cyber resilience and the expansion of intersectoral cooperation against cyberthreats.

https://cyberpolygon.com/ 

Prepping for a cyber pandemic: Cyber Polygon 2021 to stage supply chain attack simulation

https://sociable.co/technology/prepping-cyber-pandemic-cyber-polygon-stage-supply-chain-attack-simulation/ 

Scripture

1 Chronicles 29:11-13 “Yours, O Lord, is the greatness and the power and the glory and the victory and the majesty, indeed everything that is in the heavens and the earth; Yours is the dominion, O Lord, and You exalt Yourself as head over all. Both riches and honor come from You, and You rule over all, and in Your hand is power and might; and it lies in Your hand to make great and to strengthen everyone. Now therefore, our God, we thank You, and praise Your glorious name”

John 1:5 The light shines in the darkness, and the darkness has not overcome it.

John 3:19-21 And this is the judgment: the light has come into the world, and people loved the darkness rather than the light because their works were evil. For everyone who does wicked things hates the light and does not come to the light, lest his works should be exposed. But whoever does what is true comes to the light, so that it may be clearly seen that his works have been carried out in God.”

Psalm 119:105 Your word is a lamp to my feet and a light to my path.

1 Corinthians 1:19 For it is written, I will destroy the wisdom of the wise, and will bring to nothing the understanding of the prudent.

Proverbs 18:17 The first to plead his case seems right, Until another comes and examines him.

Truth Comes to Light

The Affidavit YOU Need & The Law Of Nations With Angela Albright 5/22/22

https://www.bitchute.com/video/I2zkGrHVEQV7/ 

https://www.sovereignbydesign.com/wisdoms-calling-the-blessings-of-liberti 

Digital currency

https://www.facebook.com/melissa.ciummei/videos/1042177813087597 

A Farewell To Virology (Expert Edition) 9/15/22

https://drsambailey.com/a-farewell-to-virology-expert-edition 

Stefan Lanka's work. His findings, along with the work of an independent mathematician prove that the original SARS-COV-2 GENOME CANNOT BE SEQUENCED. 2/4/22

https://brandfolder.com/s/3z266k74ppmnwkvfrxs6jjc 

'Dear scientist, researcher, investigator, we invite you to consider the following argumentation objectively and either disprove or adopt it. Please do not outsource this investigation to others, even if it will take some of your precious time. If you are a virologist or bioinformatician, fantastic! But you do not need to be an expert in order to critically research and think logically to form your own opinion. Please do not just listen to the “experts” or “trust the science”. Please do not just read one fact checker article or the defamation of a critical voice. Many people have given up their own ability to think for themselves, but not you, right? Do your own research, convince yourself with facts and uncover the truth for yourself. 3/11/22

https://truthseeker.se/wp-content/uploads/2022/03/Thought-piece-Letter-Dr.-Lanka-to-all-scientists-2.0.pdf 

WATCH: Covid19/11 – Narratives Intertwined (Full version)

https://off-guardian.org/2022/09/12/watch-covid19-11-narratives-intertwined-full-version/ 

Executive Order on Advancing Biotechnology and Biomanufacturing Innovation for a Sustainable, Safe, and Secure American Bioeconomy 9/15/22

https://www.whitehouse.gov/briefing-room/presidential-actions/2022/09/12/executive-order-on-advancing-biotechnology-and-biomanufacturing-innovation-for-a-sustainable-safe-and-secure-american-bioeconomy 

Covld. The Untold Story Behind The Pandemic.

https://paradigmshift.uscreen.io/ 

SARS-CoV-2": Bailey, Cowan, Kaufman respond to Cole, McCullough and Malone 5/3/22

https://odysee.com/@drsambailey:c/SARS-CoV-2-Bailey-Cowan-Kaufman-respond-to-Cole--McCullough-and-Malone:3 

Freedom Talk 6 / Special - Scientific response to the Corona Committee 2/11/22

https://odysee.com/@DeansDanes:1/FT-6-Special:1 

In this webinar, I discussed a recent SARS-COV-2 study published in Lancet, a prestigious medical journal. 3/16/22

https://www.researchgate.net/publication/355972541_The_Lancet_Respiratory_Medicine_Role_of_exosomes_in_false-positive_covid-19_PCR_tests 

https://www.bitchute.com/video/HxvE4DqmUWcr/ 

HOW TO LIE WITH MATHEMATICS / GOING OVER PART III OF STEFAN LANKA’S STUDY 2/11/22

https://www.bitchute.com/video/vbUeeFgrXjfC/ 

A Warrior Calls - Dr Cowan and Dr Kaufman - A Worldwide Psychological Operation 2/11/22

https://odysee.com/@I-Rabbi-T:3/Dr-Cowan-and-Dr-Kaufman---A-Worldwide-Psychological-Operation:8 

This week's podcast guest is the New Zealand physician Dr. Mark Bailey. Mark has written brilliant articles dissecting the viral scam and explaining in a clear and concise way the fraudulent science that underlies modern virology. 3/17/22

https://www.bitchute.com/video/IR0dooNod2ij/ 

In this special round table Humanley episode, Professor Igor Khmelinskii, Professor Leslie Woodcock and Professor Peter Stallinga from the University of Algarve (Portugal), join me to discuss their most recent paper titled "Role of exosomes in false-positive covid-19 PCR tests". They argue that because the Sars-CoV-2 virus has never been isolated, the PCR tests are inaccurate as they may detect our own genetic material (exosomes), giving rise to a false-positive testing pandemic. The paper was rejected for publication by the Lancet and has been downloaded more than one hundred thousand times from ResearchGate in a week (the average number of downloads for most scientific papers is about ten per week). 5/25/22

https://www.humanley.com/blog/the-humanley-podcast-episode-46 

DEBUNKING VIROLOGY & THE ENTIRE STINKING “VIRUS” NARRATIVE W/ DR. TOM COWAN 3/18/22

https://www.bitchute.com/video/6UKXePE0EUIA/ 

Featured Film: TERRAIN (part 1) 12/20/21

https://2021.theevent.global/talks/featured-film-terrain-part-1/ 

CVS PHARMACIST SAYS I SHOULD NOT BE GIVING THESE VACCINES AT ALL BUT I AM TOLD TO DO IT! 12/29/21

https://www.bitchute.com/video/u7OpzqosKVq1/ 

What You Need to Know About “Covid-19” in 2022

https://viroliegy.com/2022/01/01/what-you-need-to-know-about-covid-19-in-2022/ 

Isle of Man verifies no purification or isolation 7/10/21

https://i.postimg.cc/dV60PXGD/Isle-of-Man-verifies-no-purification-or-isolation-so-NO-covid.jpg 

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/07/Isle-of-Man-FOI-response.pdf 

In other words, the CDC in 2004 knew that researchers couldn’t reliably know these particles were coronavirus particles. Not a word has been heard about this since. All virologists use these pictures as proof of the existence of this virus. It is a fraud, based on junk science, like everything else connected with “Covid 19.” 6/11/21

https://drtomcowan.com/the-smoking-gun/ 

US hospitals: fraud, murder, cash; federal assassination-for-hire program 12/14/21

https://blog.nomorefakenews.com/2021/12/14/us-hospitals-fraud-murder-cash-federal-assassination-for-hire-program 

Stefan Lanka letter to German Minister of Health 10/15/21

https://docs.google.com/document/d/e/2PACX-1vSI7GQPpLl9zW9Kcy22FbUhMiZPSnR2Lmjsn1hX3wBIyk10LxYtNeE7vTd_DS81a_EStX8Ov99eGojG/pub 

Cowan and Lanka with Corona Investigative Committee 2/4/22

https://odysee.com/@Corona-Investigative-Committee:5/session-90-en-online:a 

DRS. THOMAS COWAN AND ANDREW KAUFMAN INTERVIEWED BY MIKE ADAMS: WHY THE "VIRUS" PANDEMIC IS A FARCE 8/30/21

https://www.bitchute.com/video/jOgLSE2m5r9n/ 

Has COVID19 Been Isolated? with Dr. Andrew Kaufman and Dr. Thomas Cowan

https://theconsciousresistance.com/has-covid19-been-isolated-with-dr-andrew-kaufman-and-dr-thomas-cowan/ 

Is Purification of a “Virus” Necessary? Yes. 1/31/22

https://viroliegy.com/2022/01/30/is-purification-of-a-virus-necessary-yes/ 

Immanuel Project - O.R.I., No. 01: bioweapons - the myth of man-made pathogens 8/31/21

https://odysee.com/@Projekt-Immanuel:3/ORI_01_bioweapons:3 

The Rumor of the “Wuhan Virus” – the origin of the (alleged) new coronavirus 8/18/21

https://projekt-immanuel.de/en/the-rumour-of-the-wuhan-virus-the-origin-of-the-alleged-new-coronavirus 

For the scientific reasons mentioned above, I argue that there is neither any pandemic nor any ‘new  virus’. 1/12/22

https://unitynewsnetwork.co.uk/welsh-pharmacist-publishes-open-letter-asking-the-pm-to-prove-the-existence-of-sars-cov-2/ 

ICAN RESPONDS TO THE DOJ’S INCORRECT CONCLUSION THAT AN EMERGENCY USE VACCINE CAN BE MANDATED 8/6/21

https://www.icandecide.org/ican_press/ican-responds-to-the-dojs-incorrect-conclusion-that-an-emergency-use-vaccine-can-be-mandated/ 

The Emperor Has No Corona.  An investigation into the "Isolation" of the SARS-COV2 "virus"7/29/21

www.brighteon.com/bcaaa489-c4c7-406d-8ed9-4f3c72d75178 

COVID Not Isolated, Cannot Be Located, Does Not EXIST! FOIA Response Reveals Worldwide HOAX! 8/7/21

https://rumble.com/vkt3mh-covid-not-isolated-cannot-be-located-does-not-exist-foia-response-reveals-w.html 

https://www.redvoicemedia.com/2021/08/stew-peters-show-foia-response-covid-cannot-be-located-school-board-100-jab-bribes-cdc-prison-camps-exposed/ 

I finally received Public Health Ontario's admission that they have no record of "SARS-COV-2" isolation/purification (thus no proof the imaginary "virus" even exists) 8/9/21

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/08/FOI-PHO-isolation-package.pdf 

Spacebusters video on germs 6/20/21

https://www.bitchute.com/video/dg1D18lNImyS/ 

Impact of CPE Control Experiment. mRNA Vaccines, nanoparticles, outlook on projects. 7/15/21

https://odysee.com/@DeansDanes:1/Freedom-Talk-3-2:b 

Radioactv interview with stefan lanka 7/12/21

https://www.facebook.com/radioactv.live/videos/247823547136150 

Claims of engineered virus. The existence of a virus must still be proven by the same method regardless of the claim.

https://lbry.tv/@TheTruthSeeker:f/VIRUS-EXISTENCE-MUST-STILL-BE-PROVEN-REGARDLESS-OF-THE-CLAIM:2 

Public Health England Admits It Cannot Scientifically Prove That COVID-19 Is Contagious 3/25/21

https://humansarefree.com/2021/03/bombshell-public-health-england-admits-it-cannot-scientifically-prove-that-covid-19-is-contagious.html 

The Delta Variant - Fact, Fiction and outright Lies (Dr. Andrew Kaufman Explains) 7/16/21

https://odysee.com/@sayerji:7/Genome-Variant-Pres-7-14-21:9 

Sars-CoV2 Isolation Court Case - RSA  5/10/21

https://www.showusthevirus.info/ 

Carcinogenic Ethylene Oxide used in sterilizing test kit swabs 4/1/21

https://docs.google.com/document/d/e/2PACX-1vQB5N9CBbKc8idP0LiU7QoRS1GeVJoIJZH3gkJIvYTdgvJPVcmbhrbqQ7lht-uHbLQYjHdOPNnBL4zc/pub 

All links to Lanka exposing virology 3/31/21

https://docs.google.com/document/d/e/2PACX-1vS18-q5y-tR6v4W

In this video we would like to introduce Project Immanuel, which critically examines the scientific background of the so-called "Corona Crisis." With the help of the natural scientist and virologist Dr. Stefan Lanka, all fundamental publications on SARS-CoV-2 and COVID-19 are closely scrutinized and scientifically examined in a series of posts.

https://www.youtube.com/watch?v=2a8eoFOnJQE 

Does This Microbiologist’s Experiment Prove that the SARS CoV-2 Virus Does Not Exist?  

https://docs.google.com/document/d/1MVbIJb0fQ-UkT2nDeBs-7IzGHlfOD6a2yz6L0cXmBuU/edit 

Misinterpretation virus III Corona simple and understandable  3/25/21

https://ia801400.us.archive.org/28/items/fehldeutung-virus-corona-teill-iii/Misinterpretation%20of%20the%20virus%20III.pdf 

CPE - Control Experiment - 21 April 2021 - English version with Dean Braus  4/23/21

https://odysee.com/@DeansDanes:1/cpe-english:f

7 WAYS TO PROVE THAT VIRUSES DO NOT EXIST: INTERVIEW WITH DR. STEFAN LANKA

https://www.bitchute.com/video/wsqhotHWmcUQ/ 

In our new format "Analysis of SARS-CoV-2 publications" we analyze and explain in detail the publications in which the claim was made that the detection of a disease-causing virus was successful.  Since Corona_Fakten kept receiving inquiries about certain publications "because these or those pretended to have provided evidence", we decided to launch precisely this new format. We will take apart all relevant publications for you and prove why no new virus was detected. This gives you the opportunity to be able to argue even better and at the same time learn to expose publications that are not suitable for this evidence. 4/15/21

https://www.samueleckert.net/machtwerk-wissenschaftliches-fehlverhalten-als-basis/ 

Stefan spoke about the history of virology, helped us to understand the many wrong turns virologists have taken over the years, and updated us on his ground-breaking study that will disprove the basic tenets of virology. 3/26/21

https://www.bitchute.com/video/oBJOwKpgtDqX/ 

Dr. Stefan Lanka & Dr. Stefano Scoglio Questions on how to end the anti-scientific conduct of virology, on algae, phages, what viruses really are, about symbionts, about water, and much more. 4/26/21

https://odysee.com/@DeansDanes:1/stefan-23-april-2021:f 

TRUST THE SCIENCE? WELL THE SCIENCE IS IN & THE SCIENCE SAYS THAT VIROLOGY NOW OFFICIALLY DEBUNKED 5/3/21

https://www.bitchute.com/video/zJkGeudHOgXz/ 

JCI Team Cirucci Interview of Dr. Andy Kaufman: “What’s wrong with you?” 4/14/21

https://www.bitchute.com/video/OAX2wDTR65dW/ 

Biology after Hamer – Part 1 Renowned molecular biologist and virologist Dr. Stefan Lanka in discussion with Ilsedora Laker of the GNM Institute   4/5/21

https://www.gnmonlineseminars.com/biology-after-hamer-part-1/ 

Part 2 of conversation between Dr Stefan Lanka and Canadian German New Medicine therapist, Ilsedora Laker 4/15/21

https://odysee.com/@GNM_Institute:d/LankaPt2:e 

Dr. Andrew Kaufman Interview – Virus Isolation, Terrain Theory & COVID-19 4/14/21

https://www.thelastamericanvagabond.com/dr-andrew-kaufman-interview-virus-isolation-terrain-theory-covid-19/ 

Dr. Andrew Kaufman refutes “isolation” of SARS-Cov-2; he does step-by-step analysis of a typical claim of isolation; there is no proof that the virus exists 4/21/21

https://blog.nomorefakenews.com/2021/04/21/isolation-of-sars-cov-2-refuted-in-step-by-step-analysis-of-claim

Dr Kaufman interview with Kamala speaking up against the tyranny 4/2/21

http://drug-dissolution-testing.com/blog/videos/Qureshi%20Kamala%203-31-21.mp4 

There Is No Virus And There Is No Covid-19, Heres Why... - Dr. Andrew Kaufman 3/28/21

https://lbry.tv/@Truth_will_set_You_Free:0/There-Is-No-Virus-And-There-Is-No-Covid-19,-Heres-Why...---Dr.-Andrew-Kaufman:5 

DR ANDREW KAUFMAN INTERVIEW WITH CLIVE DE CARLE - LUCIERIAN PLANDEMIC MANDATORY VACCINES ID-2020-66 4/2/21

https://www.bitchute.com/video/nZzpkQHXs7CN/ 

https://lbry.tv/@Truth_will_set_You_Free:0/CRITICAL-INFORMATION-WITH-DR-ANDREW-KAUFMAN-AND-CLIVE-DE-CARLE-(31_03_2021)-GEyozEcjcSUS:1 

Dr in Omaha speaks out to council 3/3/21

https://www.instagram.com/tv/CL7mTi2FCAy/?utm_source=ig_web_button_share_sheet 

Project Immanuel, which critically examines the scientific background of the so-called "Corona Crisis." With the help of the natural scientist and virologist Dr. Stefan Lanka, all fundamental publications on SARS-CoV-2 and COVID-19 are closely scrutinised and scientifically examined in a series of posts. 2/10/21

https://odysee.com/@Projekt-Immanuel:3/Announcement_Eng:6 

What "virologists" call isolation(the separation of something from everything else) is actually the opposite where they take an impure sample and put it in a cell culture usually with monkey kidney cells along with toxic agents like antibiotics and antifungals and wait for the cells to die. Since nobody has actually done a proper isolation ie: separated the particle from everything else then you cannot do experiments to prove that the particle is the cause of any illness either.

https://truthseeker.se/wp-content/uploads/2021/01/wissenschafftplus-virologists.pdf 

Interview with Dr. Stefan Lanka, Molecular & Marine Biologist by the German Magazine "Die Wurzel (the root)." 2/25/21

https://telegra.ph/How-dead-are-viruses-actually-09-04 

The evidence SUGGESTS. There is no direct evidence of human-to-human transmission of "SARS-COV-2" from respiratory transmission. Everything that has come out is indirect evidence.  DIRECT EVIDENCE is defined as evidence THAT DIRECTLY PROVES A KEY FACT AT ISSUE.  INDIRECT EVIDENCE, also referred to as circumstantial evidence, is evidence that relies on an INFERENCE to connect it to a conclusion. There is NO DIRECT EVIDENCE of human-to-human transmission of "SARS-COV-2." It is all INDIRECT EVIDENCE from which assumptions, hypotheses, and theories are drawn from and sold as conclusive.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7505025 

Statement On Virus Isolation (SOVI) 2/21/20

https://www.andrewkaufmanmd.com/sovi/ 

Patrick interviews Dr. Tom Cowan and Dr. Andrew Kaufman, two medical doctors well-versed in terrain theory. 3/20/21

https://oneradionetwork.com/all-shows/dr-tom-cowan-and-dr-andrew-kaufman-the-germ-theory-is-only-a-theory-and-viruses-as-know-them-do-not-exist-period/ 

The Contagion Myth - Mike Adams with Tom Cowan & Sally Fallon Morell 3/29/21

https://lbry.tv/@Truth_will_set_You_Free:0/The-Contagion-Myth---Mike-Adams,-Tom-Cowan-and-Sally-Fallon-Morell:5 

Dr. Andrew Kaufman Interview - Virus Isolation, Terrain Theory & COVID-19 3/5/21

https://www.thelastamericanvagabond.com/dr-andrew-kaufman-interview-virus-isolation-terrain-theory-covid-19/ 

Plato's Allegory of the Cave - Dr. Tom Cowan 4/14/21

https://lbry.tv/@Truth_will_set_You_Free:0/Plato's-Allegory-of-the-Cave:d 

COVID: An Overview 4/14/21

https://whatreallymakesyouill.com/covid-an-overview/ 

Cease and desist papers served on Prof. Dr. Christian Drosten by Dr. Reiner Fuellmich 3/9/21

https://cormandrostenreview.com/cease-and-desist-order-fuellmich-drosten 

COVID: the virus was never proven to exist; a statement from Dr. Andrew Kaufman, Dr. Tom Cowan 2/26/21

https://blog.nomorefakenews.com/2021/02/26/covid-the-virus-was-never-proven-to-exist-a-statement/ 

Special Guest Dr. Andrew Kaufman - Viruses, PCR Tests And Psychological Effects Of Masks 3/15/21

https://lbry.tv/@wakingthefuture:0/Episode-430-Dr.-Andrew-Kaufman:6 

Death of Germ Theory 2/26/21

https://earthheroestv.com/programs/death-of-the-germ-theory-2021-57431-776ba2?categoryId=57899 

https://www.facebook.com/261848620690738/videos/159955799174441 

Dr. Stefan Lanka: The history of infection theory 3/1/21

https://joedubs.com/the-history-of-infectious-disease-by-stefan-lanka/ 

The lockdown a global scientific fraud of unprecedented proportions 2/26/21

https://www.globalresearch.ca/international-alert-message-about-covid-19-united-health-professionals/5737680 

Dr Cowan 1 hour 10 min mark The Covid Vaccine On Trial: If You Only Knew 2/19/21

https://childrenshealthdefense.org/webinar/the-covid-vaccine-on-trial-if-you-only-knew-watch-now/ 

Transcript of video 2/19/20

https://childrenshealthdefense.org/transcripts/the-covid-vaccine-on-trial-if-you-only-knew/ 

Dr. Thomas Cowan Deeply Analyzes & takes the whole Virus & the PCR Test Apart 2/26/21

https://www.bitchute.com/video/eTjTkIFViZ1p/ 

DR THOMAS COWAN SYSTEMATICALLY DECIMATES THE COVID-19 LIE!

https://www.bitchute.com/video/TEThRUAWIxR1 

Dr. Lando's Official Statement On COVID-19 4 min video 2/5/21

https://lbry.tv/@alfavedic:5/dr-lando-covid:5 

The original genome for "SARS-COV-2" was stitched together in a computer based on the bronchoalveolar lavage fluid (BALF) from one patient. 2/24/21

https://docs.google.com/document/d/e/2PACX-1vT7DWgWRly0_Mq2a7E_Q1GohnLUn6UliGpeaCP7qY8czMFSSZdLQfrPUHAzXFi3aFOlhp-_O8flMIck/pub 

Phantom Virus: In search of Sars-CoV-2  2/3/21

https://off-guardian.org/2021/01/31/phantom-virus-in-search-of-sars-cov-2/ 

Fauci states COVID PCR test has fatal flaw; confession from the “beloved” expert of experts 2/23/21

https://blog.nomorefakenews.com/2021/02/22/fauci-states-covid-pcr-test-has-fatal-flaw-confession/ 

PCR test revelations from official literature; they expose their own lies 2/23/21

https://blog.nomorefakenews.com/2021/02/23/pcr-test-revelations-from-official-literature-they-expose-their-own-lies/

Massive number of flu cases are re-labeled COVID cases 3/1/21

https://blog.nomorefakenews.com/2021/03/01/massive-number-of-flu-cases-are-re-labeled-covid-cases 

Yes, the NY Times exposed the PCR test  2/23/21

https://blog.nomorefakenews.com/2021/02/18/yes-the-ny-times-exposed-the-pcr-test/ 

Virus Mania: Behind The Scenes 2/18/21

https://www.youtube.com/watch?v=OyagOj1yZis&feature=youtu.be 

Has COVID19 Been Isolated? with Dr. Andrew Kaufman and Dr. Thomas Cowan 1/14/21

https://theconsciousresistance.com/has-covid19-been-isolated-with-dr-andrew-kaufman-and-dr-thomas-cowan/ 

NO Isolation of "SARS-COV-2-19" from Australian, New Zealand, Italy, Germany, & Canadian Researchers 2/11/21

https://www.drrobertyoung.com/post/

DR. ANDREW KAUFMAN: HOW CAN YOU MAKE A VACCINE FOR SOMETHING NEVER PROVEN TO EXIST? 3/1/21

https://www.bitchute.com/video/Hk3QoUDTWtZb/ 

Dr. Andrew Kaufman interviewed on KLA TV 3/1/21

https://www.kla.tv/Coronavirus-en/18198 

"The ASSOCIATION between 2019-nCoV and the disease HAS NOT BEEN VERIFIED BY ANIMAL EXPERIMENTS TO FULFIL THE KOCH’S POSTULATES TO ESTABLISH A CAUSATIVE RELATIONSHIP BETWEEN A MICROORGANISM AND A DISEASE." 2/24/21

https://www.nature.com/articles/s41586-020-2012-7 

Response to Judy Mikovits with Tom Cowan and Andrew Kaufman 1/31/21

https://lbry.tv/@DrAndrewKaufman:f/Judy--Tom-C-1-28-21-edited-compressed1:6 

The Contagion Myth book 2/5/21

https://www.pattoverascienza.com/wp-content/uploads/2020/08/The_Contagion-MITH_W.pdf 

The Foundations and Flaws of Viral Theory 2/5/21

https://www.bitchute.com/video/PCXBWjiEJmhb/ 

THE FALLACIES OF GERM THEORY WITH DR. THOMAS COWAN 2/3/21

https://lbry.tv/@FwapUK:1/THE-FALLACIES-OF-GERM-THEORY-WITH-DR.-THOMAS-COWAN:4 

WHO reminds IVD users that disease prevalence alters the predictive value of test results; as disease prevalence decreases, risk of false positive increases.This means that the probability that a person who has a positive result (SARS-CoV-2 detected) is truly infected decreases as prevalence decreases, irrespective of the claimed specificity. 1/24/21

https://www.who.int/news/item/20-01-2021-who-information-notice-for-ivd-users-2020-05 

It’s Gene Therapy, Not a Vaccine 1/26/21

https://www.westonaprice.org/podcast/its-gene-therapy-not-a-vaccine/ 

The non-existent virus: it undercuts all other stories 2/1/21

https://blog.nomorefakenews.com/2021/02/01/the-non-existent-virus-it-undercuts-all-other-stories 

The PCR test looks for a piece of RNA in the swab sample taken from a person. That piece of RNA is PRESUMED to be part of the virus. But since you don’t have an isolated purified specimen of the virus itself, all assumptions about that piece of RNA are null and void 2/4/21

https://blog.nomorefakenews.com/2021/02/04/if-there-is-no-virus-what-is-the-test-testing-for/ 

COVID: If there is no virus, why are people dying? 2/1/21

https://blog.nomorefakenews.com/2021/01/29/covid-if-there-is-no-virus-why-are-people-dying/ 

Addendum: Peer reviewed literature and preprints covering wet-lab experiments, in silico analysis of the Corman Drosten protocol-design, meta-data analysis on EuroSurveillance.org and further discussion 1/12/21

https://cormandrostenreview.com/addendum/ 

Rethinking Biology with Dr Stefan Lanka & Dean Braus 1/22/21

https://whatreallymakesyouill.com/rethinking-biology-with-dr-stefan-lanka-dean-braus 

Dr Lanka on scientific statements 11/30/20

https://i.postimg.cc/HLmV2kMN/Dr-Lanka-on-scientific-statements.jpg 

https://truthseeker.se/wp-content/uploads/2020/11/Virologists-by-Dr-Stefan-Lanka.pdf 

What is a “scientific fact”? A small case study: the "measles process" 2/18/21

https://harald-walach.de/methodenlehre-fuer-anfaenger/17-was-ist-eine-wissenschaftliche-tatsache-ein-kleines-fallbeispiel-der-masernprozess/ 

Dr Lanka history of the infection theory

https://abruptearthchanges.com/2017/11/17/dr-stefan-lanka-the-history-of-the-infection-theory/ 

Immanuel project with Dr Lanka The aim of this project is to subject the scientific basis of the so-called "corona pandemic" to a detailed, scientific examination and to ask the provocative but absolutely necessary question 12/28/20

https://www.projekt-immanuel.de/Ueber-das-Projekt 

Dr. Stefan Lanka - Project Immanuel - Announcement 2/15/21

https://brandnewtube.com/watch/dr-stefan-lanka-project-immanuel-announcement_rbTVJcfeS91y3ST.html 

How to create your own CG “novel virus” just like the WHO’s Sars CoV2= its not real.

https://notpublicaddress.wordpress.com/2020/08/08/how-to-create-your-own-novel-virususing-computer-software/ 

The "science" of the virus that simply cannot be proven 12/30/20

https://fassadenkratzer.wordpress.com/2020/07/16/die-wissenschaft-vom-virus-das-einfach-nicht-nachzuweisen-ist/ 

"Virus madness" - background and judgment bases 12/30/20

https://fassadenkratzer.wordpress.com/2020/04/20/virus-wahn-hintergruende-und-urteilsgrundlagen/ 

There is no science behind the Covid Hoax the UN WHO’s 2020 pandemic that wasn’t.

https://notpublicaddress.wordpress.com/2020/12/02/masks-and-lies/ 

How can you claim covid positive when CDC says PCR is not to be used for diagnosis

https://i.postimg.cc/sg8h9m2n/Research-only-not-for-diagnostic-use.jpg 

Dr. Jordan Grant the supposed COV2 sequences present in many many microbes as well as the human genome.  THERE IS NO VALID TEST TO DETECT SARS-COV-2, neither antibody or antigen tests nor RT-PCR. And we included those based on the supposed gene that codes for the S1 or spike protein. (something we've postulated for a long time now) 11/10/20

https://archive.org/details/the-scam-has-been-confirmed-pcr-does-not-detect-sars-cov-2/page/n9/mode/2up 

https://ia801504.us.archive.org/16/items/the-scam-has-been-confirmed-pcr-does-not-detect-sars-cov-2/The%20scam%20has%20been%20confirmed%20-%20Dsalud%20November%202020.pdf 

To call something an “isolate” means they would have actually obtained the purified particles then done the proper experiments. 11/30/20

https://i.postimg.cc/W30YPtKv/Dr-Jordan-Grant-on-isolates.jpg 

There is no scientific proof of covid. In a FOI request dated Nov 2. CDC was unable to find or provide any proof. U.S. CDC & AGENCY FOR TOXIC SUBSTANCES & DISEASE REGISTRY HAVE NO RECORD OF A "COVID-19 VIRUS" AKA SARS-COV-2  ISOLATED FROM AN UNADULTERATED SAMPLE ANYWHERE ON EARTH BY ANYONE EVER 11/6/20

https://www.fluoridefreepeel.ca/wp-content/uploads/2020/11/USA-CDC-Virus-Isolation-Response-Scrubbed.pdf 

https://i.postimg.cc/RhQwcvhf/CDC-cannot-provide-proof-of-isolated-Covid-Sars-Cov2.jpg 

Here are 3 compilation pdfs containing ~70 responses from 53 institutions in 11+ countries/jurisdictions re the isolation/purification/existence of “SARS-COV-2” last updated April 9, 2021 (note: some of these responses were obtained by FOI-submitters other than Michael S. and myself, as indicated further down this page): 6/2/21

Part 1:

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/02/FOI-replies-SARS-COV-2-isolation-existence-causation-47-institutions-Feb-12-2021-chrono-part-1.pdf

Part 2:

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/02/FOI-replies-SARS-COV-2-isolation-existence-causation-47-institutions-Feb-12-2021-chrono-part-2.pdf

Part 3:

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/04/FOI-replies-SARS-COV-2-isolation-purification-existence-part-3-April-3.pdf

Purification/isolation of a "virus" is "outside of what is possible in Virology."  3/4/21

https://i.postimg.cc/nMbmQZ61/Purification-and-isolation-are-outside-of-what-is-possible-in-virology.jpg 

The analytical sensitivity of the rRT-PCR assays contained in the CDC 2019 Novel Coronavirus (2019- nCoV) Real-Time RT-PCR Diagnostic Panel were determined in Limit of Detection studies. Since NO QUANTIFIED VIRUS ISOLATES of the 2019-nCoV were AVAILABLE for CDC use at the time the test was developed and this study conducted Page 42  12/6/20

https://www.fda.gov/media/134922/download 

A medical diagnosis is a medical act that only a physician is legally qualified to undertake and for which such physician will be solely and entirely responsible. No other person or institution, including government agencies or the courts, has such an authority. 11/18/20

http://tapnewswire.com/2020/11/portuguese-appeals-court-deems-pcr-tests-unreliable/ 

SARS-CoV-2 has not been proven to exist; I can do this forever 12/21/20

https://blog.nomorefakenews.com/2020/12/18/sars-cov-2-has-not-been-proven-to-exist/ 

This paper will show numerous serious flaws in the Corman-Drosten paper, the significance of which has led to worldwide misdiagnosis of infections attributed to SARS-CoV-2 and associated with the disease COVID-19. External peer review of the RTPCR test to detect SARS-CoV-2 reveals 10 major scientific flaws at the molecular and methodological level: consequences for false positive results. 11/30/20

https://cormandrostenreview.com/report/ 

Virologists who claim there are pathogenic viruses are scientific fraudsters and are subject to criminal prosecution by Dr. Stefan Lanka 11/30/20

https://truthseeker.se/wp-content/uploads/2020/11/Virologists-by-Dr-Stefan-Lanka.pdf 

Dr Kaufman breaks down the Danish study that shows masks don’t make a difference

https://lbry.tv/@DrAndrewKaufman:f/Danish-Mask-Study-Revealed:3 

The innate wisdom of your body can heal itself from almost any insult. “If you support your body’s wisdom, you will return to vitality”. “Dis-ease” in the modern era is largely due to the thousands of toxins we are exposed to each and every day. 1/4/21

https://alfavedic.com/alfacast-episode/transmuting-germ-theory-through-medicamentum-authentica-w-andrew-kaufman-m-d/ 

Andrew Kaufman, M.D. with a clear, concise explanation of why and how this COVID thing is just not what we are being told 11/12/20

https://soundcloud.com/oneradionetwork/111120-kaufman-andrew 

https://oneradionetwork.com/all-shows/dr-andrew-kaufman-covid-truths-covid-lies-november-11-2020/ 

Most complete real world mask study confirms, masks don’t work. Dr Kaufman 11/19/20

https://www.youtube.com/watch?v=7ykcUbwsfK4&feature=youtu.be 

The virologists found that solutions containing  SARS-CoV-2 — even in high amounts — were NOT, I repeat NOT, infective to any of the three human tissue cultures they tested. 10/19/20

https://drtomcowan.com/only-poisoned-monkey-kidney-cells-grew-the-virus/ 

No isolation sample, all mixed with monkey kidney cells 11/12/20

https://i.postimg.cc/JnWJvcB1/No-isolation-sample-mixed-with-monkey-kidney-cells.jpg 

In other words, the sequencing of the SARS-CoV-2 virus was done by assumption and arbitrary inference. If this is science, a penguin is a spaceship. 10/19/20

https://blog.nomorefakenews.com/2020/10/19/dr-tom-cowan-explores-the-covid-virus-invented-out-of-sheer-nonsense

Conversations with Dr. Cowan and Friends Episode 12: Jon Rappoport 12/17/20

https://www.bitchute.com/video/wCYa1fUjEZyz/ 

Our government is telling us that there are no purified isolated samples of this “novel coronavirus,” which means that the virus has never been isolated and purified. 11/13/20

https://nourishingtraditions.com/the-contagion-fairy-tale-by-thomas-cowan-md-and-sally-fallon-morell/ 

THE BELIEF THAT VIRUSES ARE PATHOGENIC INVADERS IS CRUMBLING 12/6/20

https://drtomcowan.com/the-belief-that-viruses-are-pathogenic-invaders-is-crumbling/ 

Doug McKenty engages in a conversation with Dr Tom Cowan about the science behind the theory that pathogenic virus’ are the cause of disease 10/25/20

https://theshiftnow.com/the-shift-episode-55-the-contagion-myth-with-dr-thomas-cowan/ 

Dr Tom Cowan email regarding whether he would release his book.

https://i.postimg.cc/7YLXMh5z/Dr-Tom-Cowan-email-about-his-book.jpg 

Dr. Tom Cowan Contagion Myth & Unconventional Ways to Treat Viruses

https://youtu.be/KGIzWjjkpNk 

Conversations with Dr. Cowan & Friends | Ep:1 - Dr. Andrew "Andy" Kaufman 9/3/20

https://lbry.tv/@Truth_Comes_to_Light:6/Conversations-with-Dr.-Cowan---Friends---Ep1---Dr.-Andrew--Andy--Kaufman:4 

Conversations with Dr. Cowan & Friends | Ep:2 Sally Fallon Morell

https://lbry.tv/@Truth_Comes_to_Light:6/Conversations-with-Dr.-Cowan---Friends---Ep2---Sally-Fallon-Morell:d 

Dr Andrew Kaufman w/ Dr Carrie Madej on vaccines, hydrogel, gov’t 9/29/20  

https://lbry.tv/@DrAndrewKaufman:f/DrMadej:0?r=ArSAqUQQM7z8pNcnpazKZSMDNuz76xvo

Dr. Thomas Cowan / The Contagion Myth Marty Leeds 10/6/20

https://www.bitchute.com/video/6ifV1uVK3pw5/ 

Dr. Thomas Cowan, M.D., listen to this and your view and “understanding” of what a virus is, will never be the same 10/8/20

https://oneradionetwork.com/all-shows/tom-cowan-md-the-contagion-myth-why-virusesincluding-coronavirus-are-not-the-cause-of-disease-october-8-2020

ZERO Evidence that COVID Fulfills Koch's 4 Germ Theory Postulates - Dr. Kaufman & Sayer Ji

https://www.bitchute.com/video/wsMSLxTUuzzK/ 

Transmuting Germ Theory Through Medicamentum Authentica w/ Andrew Kaufman, M.D.

https://www.youtube.com/watch?v=IWRPVTxgxBg&feature=youtu.be 

If your every move and act was monitored, and controlled by an external force - a system, an authority? Would you follow the masses and comply, even to your own demise?

https://www.bitchute.com/video/pdO1eXx5l9t4/ 

We aimed to develop and deploy robust diagnostic methodology for use in public health laboratory settings without having virus material available.” 10/13/20

https://www.lewrockwell.com/2020/10/jon-rappoport/yet-another-case-of-the-missing-virus-they-lied-and-locked-down-the-world 

The virus that isn’t there has a hypnotic effect 10/14/20

https://blog.nomorefakenews.com/2020/10/14/the-virus-that-isnt-there-has-a-hypnotic-effect/ 

The “new” SARS-CoV2 was mentioned in Clinical Chemistry in 2006 10/13/20

https://academic.oup.com/clinchem/article/52/7/1446/5627058 

THE GENETIC SEQUENCE OF THE VIRUS is that map. It’s made to look like a one long code that was there all along. But it wasn’t. It isn’t.” 10/22/20

https://blog.nomorefakenews.com/2020/10/22/the-virus-that-isnt-there-genetic-sequencing-and-the-magic-trick/ 

The virus that isn’t there and the sales-job 10/25/20

https://blog.nomorefakenews.com/2020/10/23/the-virus-that-isnt-there-and-the-sales-job/

The CDC, one of the two most powerful public health agencies in the world, couldn’t get isolated virus then—couldn’t get it anywhere. 10/26/20

https://blog.nomorefakenews.com/2020/10/26/the-missing-virus-answering-critics-objections/ 

Conversations with Dr. Cowan & Friends| Ep8: Catherine Austin Fitts 10/29/20

https://www.bitchute.com/video/nzkaTOT55iQi/

https://truthcomestolight.com/dr-tom-cowan-w-catherine-austin-fitts-hidden-planetary-governance-destructive-financial-machinations-mind-control-vs-decentralized-capital-local-currencies-a-vision-for-a-healthy-world/ 

Official PROOF from UK Dept of Health that SARS COV 2 (Coronavirus) does not exist 11/2/20

https://lbry.tv/@Inconvenient-Truths:3/Official-PROOF-from-UK-Dept-of-Health-that-SARS-COV-2-(Coronavirus)-does-not-exist:e 

https://www.bitchute.com/video/BJwRLmj7aWzQ 

Once we understand how RT-PCR testing works, it becomes impossible to let the current government routine screening strategy, inexplicably supported by the virologists in the safety councils, continue.11/12/20

https://principia-scientific.com/using-pcr-tests-to-diagnose-covid19-is-bad-science-fraudulent/ 

Don’t believe the COVID case numbers; it’s a scam 11/17/20

https://blog.nomorefakenews.com/2020/11/17/dont-believe-the-covid-case-numbers-its-a-scam 

RT-PCR cannot detect a virus

https://i.postimg.cc/4Nk1hhfR/RT-PCR-CANNOT-detect-infectious-virus.jpg 

COVID19 – Evidence Of Global Fraud 11/18/20

https://off-guardian.org/2020/11/17/covid19-evidence-of-global-fraud 

A lesson on logic with what is going on today, Tom Cowan, MD

https://www.bitchute.com/video/civdVAuYQfsi/ 

To an astounding extent, COVID-19 is a NURSING HOME DISASTER 11/23/20

https://blog.nomorefakenews.com/2020/11/23/soylent-green-is-peoples-covid-19-is-old-peoples 

Why Won’t Anyone Publish the Danish Mask Study? 11/22/20

https://www.greenmedinfo.com/blog/why-won-t-anyone-publish-danish-mask-study 

Dr Hodkinson COVID - "THE GREATEST HOAX EVER PERPETUATED ON AN UNSUSPECTING PUBLIC." 11/23/20

https://www.bitchute.com/video/4v8geFvcldjS/ 

Top Pathologist Claims Coronavirus is “The Greatest Hoax Ever Perpetrated 11/25/20

https://healthimpactnews.com/2020/top-pathologist-claims-coronavirus-is-the-greatest-hoax-ever-perpetrated-on-an-unsuspecting-public/ 

Dr. Kendrick And here we dissect the lockdown “science” – like no-one else can. I would say “enjoy” – but lockdown harms are so horrific, that would not be right. 11/30/20

https://thefatemperor.com/ep102-dr-malcolm-kendrick-first-hand-experience-the-lowdown-on-lockdown/ 

BPOC 2020 is investigating the measures taken by the government in the context of Covid 19, the coronavirus, by hearing witnesses. 11/30/20

https://bpoc2020.nl/ 

Johns Hopkins study explodes covid death hoax 11/30/20

https://blog.nomorefakenews.com/2020/11/30/johns-hopkins-study-explodes-covid-death-hoax/

The SARS-Cov-2 virus was never proved to exist 12/3/20

https://blog.nomorefakenews.com/2020/12/01/the-sars-cov-2-virus-was-never-proved-to-exist/ 

Elite planners have been selling A STORY ABOUT A VIRUS. COVID-19 is essentially an intelligence-agency type covert op. 12/4/20

https://nexusnewsfeed.com/article/jon-rappoport/covert-op-the-virus-as-cover-story 

What is Covid-19, SARS-2. How is it Tested? How is It Measured? The Fear Campaign Has No Scientific Basis 12/4/20

https://www.globalresearch.ca/what-is-covid-19-sars-2-how-is-it-tested-how-is-it-measured-the-fear-campaign-has-no-scientific-basis/5722566 

Complete live viruses are necessary for transmission, not the fragments identified by PCR. https://academic.oup.com/cid/advance-article/doi/10.1093/cid/ciaa1764/6018217 

DEBUNKING THE DEBUNKERS: PCR TESTS SCIENTIFICALLY MEANINGLESS 12/6/20

https://occamsrazorterrorevents.weebly.com/blog/debunking-the-debunkers-pcr-tests-scientifically-meaningless 

COVID 19, and the subsequent governmental responses, appear to be part of an international conspiracy to commit fraud. 12/12/20

https://principia-scientific.com/covid19-evidence-of-global-fraud/ 

Dept of Justice speaker only puts on mask as prop 12/12/20

https://m.facebook.com/groups/1816658931849533/permalink/1873823729466386/?ref=m_notif&notif_t=group_r2j_approved#_=_ 

Public health journal “seeking further expert advice” on January paper about COVID-19 PCR testing by high-profile virologist  12/12/20

https://retractionwatch.com/2020/12/07/public-health-journal-seeking-further-expert-advice-on-january-paper-about-covid-19-pcr-testing-by-high-profile-virologist/ 

The Scam Has Been Confirmed: PCR Does Not Detect SARS-CoV-2 12/18/20

https://www.greenmedinfo.com/blog/scam-has-been-confirmed-pcr-does-not-detect-sars-cov-2 

Peggy Hall joins Amandha Vollmer in this dive into the psychological warfare of 2020 12/21/20

https://www.bitchute.com/video/rTLl5StJXwex/ 

Cease and desist papers served on Prof. Dr. Christian Drosten by Dr. Reiner Füllmich 12/21/20

https://drive.google.com/file/d/17X4GmMXn_m-vDwqEy9vMhbNqzodAEW3b/view 

Landmark legal ruling finds that Covid tests are not fit for purpose 12/22/20

https://www.rt.com/op-ed/507937-covid-pcr-test-fail/ 

HSE Finally Admit That Covid19 Has Not Been Scientifically Proven To Exist 12/28/20

https://principia-scientific.com/irish-government-admits-covid-19-does-not-exist/ 

https://gemmaodoherty.com/investigations/hse-finally-admit-that-covid19-has-not-been-scientifically-proven-to-exist/ 

Italian scientist tests kiwi for covid and it came back positive 12/28/20

https://t.me/kellybroganmd/724 

The five key events in the fake pandemic 12/28/20

https://blog.nomorefakenews.com/2020/12/22/the-five-key-events-in-the-fake-pandemic/ 

The defendants knowingly relied upon the following dishonest statements for material gain, in breach of section 2 of the Fraud Act 2006: 12/28/20

https://principia-scientific.com/prima-facie-evidence-of-covid-19-pandemic-fraud-in-uk/ 

Portuguese Appeals Court Deems PCR Tests Unreliable 12/28/20

https://anti-empire.com/portuguese-appeals-court-deems-pcr-tests-unreliable-throws-out-quarantine-by-apparatchik-decree/ 

Can You Really Catch the Flu from Someone? 12/31/20

https://brendandmurphy.com/wp-content/uploads/2020/12/Can-You-Really-Catch-the-Flu-by-Brendan-D.-Murphy-PDF.-Murphy-PDF.pdf 

Asymptomatic transmission of COVID-19 didn’t occur at all, study of 10 million finds 1/4/21

https://www.lifesitenews.com/news/asymptomatic-transmission-of-covid-19-didnt-occur-at-all-study-of-10-million-finds 

Bio-warfare & Weaponization of Medicine Amid Covid 1/29/21

https://thenewamerican.com/bio-warfare-weaponization-of-medicine-amid-covid 

The U.S. Medical Profession Is Corrupt, Criminal, and Is Run By the State and Pharmaceutical Industry 2/6/21

https://www.garydbarnett.com/the-u-s-medical-profession-is-corrupt-criminal-and-is-run-by-the-state-and-pharmaceutical-industry/ 

How do they prove that viruses cause disease actually?

https://docs.google.com/document/d/17kQC8RKZrFLKwnPhcn1Y81_twJT-XCasclcsnBMJbOw/edit 

Knowledge is power. Knowledge of how to have health gives greatest power. J.L. Tilden

https://docs.google.com/document/d/1PO9tnS199CFUCXBnDygnqUTAtrRoM2kJUwv9hlQLRvc/edit 

What Really Makes Us Sick? The Terrain or the Germ? Part I 2/7/21

https://www.humanley.com/blog/what-really-makes-us-sick-the-terrain-or-the-germ-part-i

What Really Makes Us Sick? The Terrain or the Germ? Part II 2/7/21

https://www.humanley.com/blog/what-really-makes-us-sick-the-terrain-or-the-germ-part-ii 

An investigation of viruses and vaccines, HIV and AIDS 2/21/20

http://davidpratt.info/roberts.htm 

Germ Theory is Satanic deception aimed at damaging and even destroying God's creation.

https://www.cgg.org/index.cfm/library/commentary/id/5142/a-tale-two-frenchmen.htm 

This blog and telegram channel serves to educate about the lacking scientific evidence for the existence of viruses, history of virology, infectious disease theory, vaccination and especially the corona pandemic and all related topics. 2/25/21

https://telegra.ph/Corona-Investigative-09-26 

Defeating COVID Test Fraud: Memo to Lawyers and Clients 2/26/21

https://blog.nomorefakenews.com/2021/02/25/defeating-covid-test-fraud-memo-to-lawyers-and-clients/

Can everything we know about germs be wrong? Terrain Theory for Dummies 2/28/21

https://earthheroestv.com/programs/live-broadcast-with-special-guests-66356-17b8c4 

German Investigative Journalists Still Searching for Proof that Sars-CoV-2 Exists 2/28/21

https://medicalkidnap.com/2021/02/03/german-investigative-journalists-still-searching-for-proof-that-sars-cov-2-exists/ 

If I told you germs and viruses don't cause disease! That you can't "catch" another person's illness. Coughs and sneezes DON'T spread diseases! You may think I am crazy. Read for yourself and make your own decision.3/3/21

https://www.bioregmed.org/the-germ-theory-debunked/

THE RIDICULAR VARIATIONS OF SARS-COV2 Dr Scoglio 3/3/21

https://www.databaseitalia.it/le-ridicole-varianti-del-sars-cov2 

The so-called "SARS-CoV-2 genetic primers" compared with a database of the Human Genome. The result: each and every one of the "Coronavirus" sequences are present in various parts of our Genome; so, as far as I can see, the PCR is either detecting free-floating DNA and "reverse-transcribing" it to RNA... or it is detecting exosomic ARN, which was once created inside the human cells based on our DNA 3/3/21

https://docs.google.com/spreadsheets/d/1uNoijuXDg5tzstEuaxtOrYv3fZ0Nyc405_thJY4-BBg/edit 

WHO INSIDERS BLOW THE WHISTLE ON TOTAL IMMUNITY OF BILL GATES THROUGH GAVI - GLOBAL VACCINE ALLIANCE 3/5/21

https://www.bitchute.com/video/JEgdTWXunOfZ 

Fact-Checking Facebook’s Fact Checkers The media giant is employing left-wing vetters to limit scientific debate. 3/7/21

https://www.wsj.com/articles/fact-checking-facebooks-fact-checkers-11614987375 

Dr. Scott Jensen, WHO Confirm: ‘We’ve All Been Played’ on COVID-19 3/7/21

https://21stcenturywire.com/2021/03/07/dr-scott-jensen-who-confirm-weve-all-been-played-on-covid-19 

If you die from Coronavirus ‘vaccine’, your life insurance won’t pay as it’s an ‘experimental medical intervention’ 3/8/21

https://tapnewswire.com/2021/03/if-you-die-from-vaccine-your-life-insurance-wont-pay-as-its-an-experimental-vaccine 

By the “sorceries” of Babylon all nations were deceived. The Greek word for “sorceries” in verse 23 is “pharmakeia” [far-mak-i’-ah]. According to the Thayer Greek Dictionary “pharmakeia” is “the use or administering of drugs; poisoning; and sorcery, magical arts, often found in connection with idolatry and fostered by it.”

https://www.pathwaytopeace.net/index.php/blogs-and-articles/pharmakeia-deception 

“People need to be taught that drugs do not cure disease. It is true that they sometimes afford present relief, and the patient appears to recover as the result of their use; this is because nature has sufficient vital force to expel the poison and to correct the conditions that caused the disease. Health is recovered in spite of the drug. But in most cases the drug only changes the form and location of the disease. Often the effect of the poison seems to be overcome for a time, but the results remain in the system, and work great harm at some later period. By the use of poisonous drugs, many bring upon themselves lifelong illness, and many lives are lost that might be saved by the use of natural methods of healing.” - Ellen White, Counsels on Health, p. 89

https://m.egwwritings.org/en/book/20/toc 

Experts Stating that There Is No Proof that the Particles Named SARS-CoV-2 Belong to a Disease-Causing Virus 3/11/21

https://www.torstenengelbrecht.com/en/home/ 

Legal Death In Drugs We Trust 3/13/21

https://www.youtube.com/watch?v=fdlZKDQHmq0 

As much of the world rushes to receive a lightly-tested pharmaceutical product, we thought it was high time to look again at the (very) big business of medicine. Leemon McHenry, PhD, guides us to the fraudulent core of ghostwritten studies, captured legislators, revolving-door regulatory agencies, pay-to-play medical journals, and the "key opinion leaders" who lend their academic credentials to giant corporations...for a price.  3/15/21

https://www.youtube.com/watch?v=UAEAWyfuEWY 

Origins of Rockefeller Medicine - The 1910 Flexner Report

https://www.bitchute.com/video/0y3wLzQ0Vlo4/ 

No control experiments have been carried out to confirm that the structure is not different from that assumed to exist • if this structure has not been isolated from all other components • e.g. the so-called HIV, measles and smallpox virus images clearly show 3/27/21

https://threadreaderapp.com/thread/1355515264155181062.html 

THE DANGERS OF ETHYLENE OXIDE IN THE PCR TEST 3/27/21

https://www.bitchute.com/video/dIgVOTtP7hqK/ 

Pandemics Explained By Terrain Theory 4/9/21

https://lordchewy.medium.com/pandemics-explained-by-terrain-theory-2181182fb404 

Reasons To Reject The Germ Theory of Disease 4/9/21

https://lordchewy.medium.com/31-reasons-to-reject-the-germ-theory-of-disease-9c5e1a3327f3 

Study: CDC Scientists Make 2 COVID Admissions That Destroy Official Narrative 4/13/21

https://luis46pr.wordpress.com/2020/11/02/study-cdc-scientists-make-2-covid-admissions-that-destroy-official-narrative/ 

#1 COVID Admission: The Computer-Generated Frankenstein Virus: CDC Scientists Admit Only Using 37 Base Pairs From Real Tissue To Assemble SARS-CoV-2 #2 COVID Admission: CDC Scientists Found That SARS-CoV-2 Didn’t Infect Human Tissue

https://wwwnc.cdc.gov/eid/article/26/6/20-0516_article 

Reiner Fuellmich - We have the Evidence 4/13/21

https://odysee.com/$/embed/Reiner-Fuellmich-Evidence/04f5237ef0c37642958701ae74c512d5IIn other words, our government is telling us in July 2020—after plunging millions of people into poverty with a worldwide lockdown—that no purified isolated samples of this “novel coro­navirus” exist, which means that the virus has never been isolated and purified. What they are finding in the RT-PCR swab tests are fragments of genetic material, one of which is found in human DNA.2 This means that the results of all RT-PCR tests are invalid—the only thing they can tell us is that we are human beings.

https://nateserg808.wixsite.com/my-site/post/timeless-summer-items-every-closet-must-have2a2aecc1 

What the C crisis is really about. A natural perspective. 4/14/21

https://currenthealthscenario.blogspot.com/2021/03/what-c-crisis-is-really-about-natural.html 

“She blinded me with science” 4/9/21

https://docs.google.com/document/u/1/d/e/2PACX-1vTceGP_yB2txmKkX09BcUq079ZQdVAi0W72WcypPUWeu0e3mLdrhEWjk_Eu8oBr2HkKj-TGNBYLjEXu/pub

COV-19 IMMUNITY IN 19 MINUTES 4/26/21

https://www.bitchute.com/video/EdffVJbFxb96/ 

Public Health Act 2016 (WA) – Instrument of Authorisation – Authorisation to Supply or Administer a Poison [SARS-COV-2 (COVID-19) VACCINE – Australian Defence Force] (No.2) 2021 4/28/21

https://www.wa.gov.au/government/publications/public-health-act-2016-wa-instrument-of-authorisation-authorisation-supply-or-administer-poison-sars-cov-2-covid-19-vaccine-australian-defence-force-no2-2021 

Phantom Virus: In search of Sars-CoV-2

https://off-guardian.org/2021/01/31/phantom-virus-in-search-of-sars-cov-2/ 

COVID: An Overview David Parker and Dawn Lester  6/2/21

https://whatreallymakesyouill.com/covid-an-overview/ 

Christine Massey on isolation and FOIA requests

https://www.youtube.com/watch?v=FHi1pofmCkQ 

Hippocratic Hypocrisy Dr Kaufman and Spacebusters

https://www.youtube.com/watch?v=wbigfSB1_Yg 

Covid-19 Myths webinar with Dr. Andrew Kaufman & Dr. Tom Cowan

https://www.facebook.com/mike.tesero.1/videos/499389358150303 

The manager of an upstate NY restaurant and tavern just told me, as I was paying my check, that he got a call from the State Liquor Authority yesterday, and this is what he was told “They said I had to take all my mask signs down on all the doors, entrances, all through the restaurant, because it is no longer legal to ask people to wear masks,” said Marty Miller, General Manager of the Amenia Steak House in Amenia NY. “They also said I am not allowed to ask people to show vaccination cards because it is a violation of HIPPA laws.” 5/21/21

https://uncoverdc.com/2021/05/20/ny-state-liquor-authority-its-now-illegal-to-require-masks/ 

Do Germs Cause Disease? The Germ Theory Under the Microscope

https://www.youtube.com/watch?v=hW0H4llB06c 

Corona: The comprehensible and verifiable refutation of the virus allegations

https://telegra.ph/corona-the-comprehensible-and-verifiable-refutation-of-the-virus-allegations-10-29

Epidemic authority confirmed: Neither virus-existence research nor control experiments performed

https://telegra.ph/Epidemic-authority-confirmed-Neither-virus-existence-research-nor-control-experiments-performed-10-15

These questions make every virologist nervous

https://telegra.ph/These-questions-make-every-virologist-nervous-09-30

The Federal Court of Justice destroys the belief in Viruses

https://telegra.ph/The-Federal-Court-of-Justice-destroys-the-belief-in-Viruses-08-28

Dr Kaufman addresses questions about studies and if viruses are isolated.  

https://videos.files.wordpress.com/R6frtURb/covid-19-myths-bonus-material_mp4_hd.mp4 

Part 1 Dr Tom Cowan and Dr Andy Kaufman explain precisely why you can be sure that no virus exists as a pathogenic agent of disease. They go into virus isolation - how it is done, and how it should be done. 6/2/21

https://odysee.com/@LawfulRebel:9/pandemicfundamentals:5

Part 2 Dr Tom Cowan and Dr Andy Kaufman explain precisely why you can be sure that no virus exists as a pathogenic agent of disease. They go into virus isolation - how it is done, and how it should be done.6/2/21

https://www.bitchute.com/video/x9NscWwmG1nS/

Sars-CoV2 Isolation  Court Case – RSA 6/2/21

https://www.showusthevirus.info/

DR. TOM COWAN LIVESTREAM: Q&A FROM FRIDAY, MAY 28TH

https://www.bitchute.com/video/Z4zpVDrcd2Z8/ 

EP. 2 – Viruses, Contagion, & Butterscotch Pudding

https://www.youtube.com/watch?v=UtLgo6Vrscg 

Hunting for Viruses with Dr Andy Kaufman Odysee Exclusive 6/8/21

https://odysee.com/@drsambailey:c/Odysee-Hunting-Viruses-With-Andy-Kaufmann-1-comp:7?r=Hi235fbeSxXgEvHPARxCiew2F8RbaKHc 

RENOWNED SCIENTIST SPEAKS OUT! - COVID IS A SCAM! - DON'T GET THE JAB! - DO VIRUSES EXIST? 6/15/21

https://www.bitchute.com/video/7D1h83p0Q7oE/ 

All truth to light links in document

https://docs.google.com/document/d/e/2PACX-1vSvcy9gDUhjZDtmATjaCuXO3oFnumrRgKxGA0mVXr4mDN5CKdp6DoArgNyF0Bn-wHN5on1ItIKnSoYJ/pub 

Bob Stagnitto posts on instagram

https://www.instagram.com/terrainmodel/ 

Stefan Lanka: “And as soon as I get hold of original sequence data which was produced for HIV, I am going to produce you [the] coronavirus. Definitely! And this is going to be the definitively experimental disproval of virology.”

http://www.integralworld.net/visser203.html 

Stefan Lanka Viruses are not microbes and have no infection capacity

https://www.dsalud.com/reportaje/stefan-lanka-los-virus-no-son-microbios-y-no-tienen-capacidad-infectiva-y-iii/ 

"Dr. Sadaf Gilani of Ottawa, Canada has carefully researched COVID-19 and the "virus" that supposedly caused it since the beginning of the lockdowns. In this conversation we cover the field regarding the virus, the testing, the lockdowns, the bioweapon question, and the injections. What are we facing? Follow Dr. Gilani on Facebook." 6/23/21

https://www.podomatic.com/podcasts/progressivespirit/episodes/2021-06-23T08_56_41-07_00

https://progressivespirit.net/2021/06/23/sadaf-gilani-inconvenient-truths-about-sars-cov-2/

Hydrogen cyanide same symptoms as covid

https://i.postimg.cc/KjpWzFsJ/Hydrogen-Cyanide-very-similar-symptons-to-CV.jpg 

Is HIV to AIDS what SARSCoV-2 is to COVID? 6/29/21

https://s3.amazonaws.com/kajabi-storefronts-production/sites/53102/downloads/0Fl6sg7RNqmqBNZlUwsw_COVID_HIV.pdf 

Exclusive Interview With Dr. André Dias, At Center Of Portugal FOIA Court Case Confirming Covid Statistical Fraud: "They Replied To All: "We Have Nothing" " 6/29/21

https://celiafarber.substack.com/p/exclusive-interview-with-dr-andre 

Pharmakeia deception

https://www.pathwaytopeace.net/index.php/blogs-and-articles/pharmakeia-deception 

What is germ theory and why is it so important to know what it is and why it is controlling the world

https://odysee.com/@northerntracey:a/erD483GOAf8m:f 

COVID-19 Not a Virus:  Can Any Scientist Prove Dr. Stefan Lanka Wrong? 7/12/21

https://newswithviews.com/covid-19-not-a-virus-can-any-scientist-prove-dr-stefan-lanka-wrong/

HSE NHPET IRELAND FINALLY ADMIT THAT A COVID-19 VIRUS HAS NOT BEEN SCIENTIFICALLY PROVEN TO EXIST 7/13/21

https://www.bitchute.com/video/SlttztHJKEj7/ 

How They Find Viruses 1 minute video 7/13/21

https://www.youtube.com/watch?v=Yg5qnmqjWsM 

Burke, Pasteur, and the Rhetoric of Science

https://www.slideshare.net/jthomaswright/burke-pasteur-and-the-rhetoric-of-science 

Louis Pasteur Vs Antoine Béchamp and The Germ Theory of Disease Causation - 1

http://www.laleva.org/eng/2004/05/louis_pasteur_vs_antoine_bchamp_and_the_germ_theory_of_disease_causation_1.html 

The DELTA Variant is Total FAKE NEWS 7/26/21

https://freeworldnews.tv/watch?id=60f9e83673a7b3082db33cc0 

CDC/FDA confess: they had no virus when they concocted the test for the virus 7/29/21

https://blog.nomorefakenews.com/2021/07/29/cdc-fda-confess-they-had-no-virus-when-they-concocted-the-test-for-the-virus 

Reclaiming Our Health: Germ Theory Exposed

http://www.davidpratt.info/reclaim.htm 

An investigation of viruses and vaccines, HIV and AIDS

http://www.davidpratt.info/roberts.htm 

Dr. Martín Monteverde, spokesman for the group of health professionals who submitted the request for the report on the isolation of SARS-CoV-2 in Argentina, and who announced that graphene oxide was found in Vaxigrip Tetra 7/30/21

https://rumble.com/vkizdu-dr.-martn-monteverde-non-existence-of-sars-cov-2-pcr-farce-graphene-flu-jab.html 

We have no substitute for drug medicines. We let them alone as evil things, and prescribe good things. We cannot reform or change a falsehood. We have only to teach the truth. Our system is independent of all others. 8/2/21

https://soilandhealth.org/wp-content/uploads/GoodBooks/Mans%20Pristine%20Way%20of%20Life.pdf 

Published scientist admits Zero evidence that covid-19 virus exists in the physical world 8/2/21

https://www.brighteon.com/37810944-72c7-422c-9712-82ce1fa5a51a 

Murder in the Care Home – The pandemic response 4 years in the planning 8/2/21

https://dailyexpose.co.uk/2021/07/31/murder-in-the-care-home-pandemic-plan/ 

It has taken us over a year to win disclosure of these secret documents prepared by NHS England for the Department of Health & Social Care in 2017/18. They address a pandemic influenza but they are clearly relevant for UK pandemic management during COVID-19. 8/2/21

https://cygnusreports.org/pandemic-briefing-papers/ 

Murder iCDC, FDA Faked “Covid” Testing Protocol By Using Human Cells Mixed With Common Cold Virus Fragments… PCR Tests Are Merely Detecting The Common Cold 8/2/21

https://www.citizensjournal.us/breaking-cdc-fda-faked-covid-testing-protocol-by-using-human-cells-mixed-with-common-cold-virus-fragments-pcr-tests-are-merely-detecting-the-common-cold/ 

Here are 5 compilation pdfs containing FOI responses re the isolation/purification/existence of “SARS-COV-2”, as well as emails from authors of studies that claimed to have “isolated the virus” and an email from the Head of the Consultant Laboratory for Diagnostic Electron Microscopy of Infectious Pathogens at Germany’s Robert Koch Institute. As of July 30, 2021: 90 institutions and offices in 24 countries/jurisdictions (note: many of these responses were obtained by FOI-submitters other than Michael S. and myself, as indicated further down this page):

https://www.fluoridefreepeel.ca/fois-reveal-that-health-science-institutions-around-the-world-have-no-record-of-sars-cov-2-isolation-purification/

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/02/FOI-replies-SARS-COV-2-isolation-existence-causation-47-institutions-Feb-12-2021-chrono-part-1.pdf

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/02/FOI-replies-SARS-COV-2-isolation-existence-causation-47-institutions-Feb-12-2021-chrono-part-2.pdf

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/04/FOI-replies-SARS-COV-2-isolation-purification-existence-part-3-April-3.pdf

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/06/FOI-replies-re-SARS-COV-2-purification-existence-June-3-2021-part-4.pdf

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/07/FOI-replies-re-SARS-COV-2-purification-existence-July-13-2021-part-5.pdf

The Practice of Medicine & The First 3 Commandments: General Considerations

http://bmei.org/the-practice-of-medicine-the-first-commandment-general-considerations/ 

http://www.biblicalworldview21.org/bmei/jbem/volume1/num4/pomerantz_medicine_and_the_second_commandment.html 

http://bmei.org/medicine-and-the-third-commandment-i-of-lawful-oaths-and-vows/ 

Dr. Martín Monteverde: Non existence of SARS-CoV-2, PCR farce, graphene flu jabs. 7/30/21

https://rumble.com/vkizdu-dr.-martn-monteverde-non-existence-of-sars-cov-2-pcr-farce-graphene-flu-jab.html 

One such paradigm is that germs are enemy combatants, and that viruses serve no fundamental role in our health, and should be eradicated from the earth with drugs and vaccines, if possible. This belief, however, is untenable. With the discovery of the indispensable role of the microbiome, and the subpopulation of viruses within it - the virome - we have entered into an entirely new, ecologically-based view of the body and its environs that are fundamentally inseparable. Ironically, the only thing that influenza may be capable of killing is germ theory itself. For an in-depth exploration of this, watch the lecture below on the virome. I promise, if you do so, you will no longer be able to uphold germ theory as a monolithic truth any longer. You may even start to understand how we might consider some viruses "our friends," and why we may need viruses far more than they need us.

https://youtu.be/TRVxTBuvChU

Iatrogenesis; How Corrupt is the Mainstream Medical System?

https://www.weblyf.com/2020/09/iatrogenesis-how-corrupted-is-the-mainstream-medical-system 

“If there is no virus, why are all these people dying?” 8/6/21

https://blog.nomorefakenews.com/2021/08/03/if-there-is-no-virus-why-are-all-these-people-dying/ 

PAT KING VS. DEENA HINDSHAW ALBERTA CMOH!! SHE DIDN’T SHOW, AND NO EVIDENCE OF VIRUS 8/5/21

https://www.bitchute.com/video/CxYBFlyrapPL/ 

Daniel King Court Case In Alberta Showing Corona Does Not Exist 8/6/21

https://odysee.com/@PressForTruth:4/Pat-King-Interview:6 

Patriot Patrick King represented himself in court after being fined $1200 dollars for protesting against the Covid-Hoax, he slew the beast and emerged VICTORIOUS.  He issued a subpoena to the Provincial Health Minister for proof that the so-called Covid-19 Virus exists, and they were forced to admit that they had no evidence whatsoever. The virus has never been isolated, and thus the government had no legal grounds to impose any of the punishing restrictions they have inflicted on society. 8/6/21

https://www.globalresearch.ca/video-canadian-court-victory-proves-covid-19-hoax-all-restrictions-dropped/5752088 

"Let’s be clear: the work of science has nothing whatever to do with consensus. Consensus is the business of politics. Science, on the contrary, requires only one investigator who happens to be right, which means that he or she has results that are verifiable by reference to the real world. In science consensus is irrelevant. What is relevant is reproducible results. The greatest scientists in history are great precisely because they broke with the consensus. There is no such thing as consensus science. If it’s consensus, it isn’t science. If it’s science, it isn’t consensus. Period.

https://www.israelnationalnews.com/News/News.aspx/294192 

Propaganda and Irrational Fear - Discussion by Professor Mark Crispin Miller 8/6/21

https://www.youtube.com/watch?v=Db2ZYGRdUPk 

Our fifth conversation with Johnny Cirucci 8/12/21

https://whatreallymakesyouill.com/our-fifth-conversation-with-johnny-cirucci

Resources to help you defend your human and democratic rights and freedoms, and your health and safety, against authoritarian measures in medical disguise.

https://doctors4covidethics.org/resources-2 

There is NO "SARS CoV - 2 or SARS CoV - 19 Virus that has been scientifically isolated using the scientific "Gold Standard" of Koch or Rivers Postulates showing existence by anyone, anywhere in the World! 8/13/21

https://www.drrobertyoung.com/post/freedom-of-information-responses-on-cov-2 

NO DIRECT TRANSMISSION STUDIES had ever been done: 8/13/21

https://docs.google.com/document/d/e/2PACX-1vTCnifa-4119hh9OayVycLPxze_3xXW3TGVPlpdAbSY9XaYPzOZOJdf58GOay5rz5pn5sMutu_Mkp0n/pub

Government Data Destroys Public Official Covid Claims, Covid-19 Deaths, Cases, Hospitalization 8/17/21

https://www.unite4truth.com/post/government-data-destroys-public-official-covid-claims-covid-19-deaths-cases-hospitalization 

YOU ARE BEING SCAMMED: Lab admits there is no test for COVID variants 8/18/21

https://rumble.com/vklzhs-you-are-being-scammed-lab-admits-there-is-no-test-for-covid-variants.....html 

This document was allegedly submitted to the High Court in Christchurch on July 21, 2021.

https://www.docdroid.net/l69Brc8/heterodoxies-high-court-action-pdf 

https://www.ukcolumn.org/community/documents/the-heterodoxies-society-vrs-the-nz-govt/ 

https://thevirushoax.atlassian.net/wiki/spaces/VIRUS/pages/831455233/Heterodoxies+High+Court+Case 

https://www.dropbox.com/s/m7l13qsgg66wrp5/zoom_0.mp4?dl=0 

Are you confused and frustrated by people saying “viruses don’t exist”? I hope this video will provide the necessary context and add clarity to what we actually mean.

https://www.bitchute.com/video/pLgZfUIK1Exq 

Chapter One of a new documentary series about the occult history of the medical industrial complex.  9/2/21

https://rokfin.com/post/52077 

"Science is Real" and other idiocies Brass Check 9/2/21

https://www.youtube.com/watch?v=3QF9a-IR4w0 

DR. BRYAN ARDIS - HOSPITAL PROTOCOL IS WHAT IS MURDERING COVID / FLU PATIENTS 9/7/21

https://www.bitchute.com/video/BKBpP5blJ21B/ 

Our I CEE YOU Story First Hand- What Is ACTUALLY killing people! My HUBBY WALKED OUT IN 3 & 1/2 DAYS

https://www.youtube.com/watch?v=5wCf2X0kL90 

Health is more than influenza 9/7/21

https://archive.ph/2nzdG#selection-5877.0-5877.29 

Alphonse Faggiolo, is an expert in real law strategies. He has been helping people win in court using successful law strategies. Andrew Kaufman and Alfonse discuss how to handle Covid-19 restrictions and mandates and give examples of methods to employ against mask and vaccine mandates. 9/8/21

https://andrewkaufmanmd.com/interview-with-dr-andrew-kaufman-alphonse-faggiolo 

Trump pushes vax 9/16/21

https://www.newsweek.com/donald-trump-pushes-covid-19-vaccine-says-he-very-proud-it-1620880 

https://www.theguardian.com/us-news/2021/aug/22/donald-trump-rally-alabama-covid-vaccine 

Interview with Dr. Stefan Lanka, Dr. Tom Cowan & Dr. Andrew Kaufman 9/23/21

https://odysee.com/@DeansDanes:1/Freedom-Talk-4:f?r=HoHY42PwffXYhSKRRQvrPPxS5denk9gg 

How I Woke Up Dr Sam Bailey 9/23/21

https://odysee.com/@drsambailey:c/how-i-woke-up...:3 

Where is the Biden Executive Order mandating the vaccine? I’m talking about the Executive Order (EO) commanding all US companies with more than 100 employees to mandate the COVID vaccine for those employees. 10/5/21

https://blog.nomorefakenews.com/2021/10/05/wheres-the-biden-executive-order-mandating-the-vaccine 

CDC fabricates the de-pop jab uptake stats 10/6/21

https://odysee.com/@Welcometheeagle88:4/ALERT--CDC-fabricates-the-de-pop-jab-uptake-stats!-No-surprise:6 

SPANISH HIGH COURT CONFIRMS THAT COVID 19 DOES NOT EXIST! 10/12/21

https://www.bitchute.com/video/nXt3lz5N1VrB/ 

If isolation is impossible, if these viruses swim forever in liquid inside cells, un-isolated, then HOW DID SCIENTISTS FIRST DISCOVER VIRUSES EXIST? 10/12/21

https://blog.nomorefakenews.com/2021/10/12/viruses-cant-be-isolated-but-isolation-is-unnecessary 

The virus that doesn’t exist: lies and consequences 10/14/21

https://blog.nomorefakenews.com/2021/10/14/the-virus-that-doesnt-exist-lies-and-consequences/ 

Henna Maria Stepping Out of the Chessboard - Exposing Controlled Opposition 10/15/21

https://www.youtube.com/watch?v=keG4TvYENaY 

All fall of cabal links

https://www.bitchute.com/channel/ws4fMTn6yNc7/ 

A union representing the rights of public-sector workers has called for the suspension of rapid tests for the coronavirus, after media reports showed a swab contained multiple times the permissible trace level of ethylene oxide, a toxic substance. 10/27/21

https://cyprus-mail.com/2021/10/26/union-calls-for-suspension-of-rapid-testing-after-toxic-substance-found/ 

Four Basic Assumptions re Covid Renton 11/3/21

https://www.youtube.com/watch?v=XDWhtyEAkFk

Isolate the V!rus using the gold standard of #virology #riverspostulates speaker:

https://www.facebook.com/SayedHussainZ/videos/422533759589481 

https://www.instagram.com/j_class_travels/ 

You say, trust the science…

https://docs.google.com/document/d/e/2PACX-1vSOhG1_7rJJVqscUzQNFEZ6QP6AiQ4MKF4L9FOwt7E2oJRZE_s1KEbTZIG1T4aqZC6BuCja1C2rFkwY/pub

RESOURCE: Tracking Legal Action & Legislation Against Covid-19 Mandates

https://www.coreysdigs.com/law-order/resource-tracking-legal-action-legislation-against-covid-19-mandates/ 

The Virus Misconception: The Killer Virus Story vs. Deficiency and Toxicity

http://wamangcolosi.org/the-virus-misconception/ 

Feds are paying hospitals to provide poor – and deadly – COVID care 11/17/21

https://www.wnd.com/2021/11/feds-paying-hospitals-provide-poor-deadly-covid-care/ 

The Trueman Show #44 Brecht Arnaert Brecht is an economist, ex-political worker, editor-in-chief of www.macrotrends.be, researcher of the occult side of the monetary system, PhD student at Universidad Rey Juan Carlos in Madrid and has been doing research for many years about how the world works. His latest research was focused on health and the existence of viruses. 11/22/21

https://www.youtube.com/watch?v=ieukuWPuPZI 

Research summary and debunk regarding the existence of “SARS-CoV-2” and “COVID-19”

https://truthseeker.se/research-summary-and-debunk-regarding-the-existence-of-sars-cov-2-and-covid-19 

Ivermectin friend or foe? 11/24/21

https://www.bitchute.com/video/3GGjYlLVqP4g 

LYING ABOUT THE EFFECTIVENESS OF THE COVID-19 SHOTS FROM THEIR OWN MOUTHS 2 min video 12/8/21

https://www.bitchute.com/video/n7o5zN2iBIWX 

New Study published by top British Biomedical Scientist proves the Covid-19 Fraud is a Crime against Humanity 12/8/21

https://dailyexpose.uk/2021/12/03/new-study-proves-covid-is-a-fraud/ 

Freedom Talk 5 - Andy, Tom, Stefan, Dean 12/8/21

https://odysee.com/@DeansDanes:1/Freedom-Talk-5:b 

EP. 2 – Viruses, Contagion, & Butterscotch Pudding

https://www.youtube.com/watch?v=UtLgo6Vrscg 

New COVID at-home test dangerous and misleading: but everybody’s doing it, so who cares, right? 1/3/22

https://blog.nomorefakenews.com/2021/12/30/new-covid-at-home-test-dangerous-and-misleading-but-everybodys-doing-it-so-who-cares-right/ 

Both sides of the virus debate. Virologist admits no virus ever found in fluids 1/19/22

https://www.instagram.com/p/CYzhPjcAQcz 

“It is simply no longer possible to believe much of the clinical research that is published, or to rely on the judgment of trusted physicians or authoritative medical guidelines. I take no pleasure in this conclusion, which I reached slowly and reluctantly over my two decades as an editor of The New England Journal of Medicine.”

https://judahstclinic.com/news/2013/12/14/nejm-editor-no-longer-possible-to-believe-much-of-clinical-research-published 

TERRAIN THE FILM - BEHIND THE SCENES 2/2/22

https://www.bitchute.com/video/Xe4SEoOv45L1/ 

These resources are of like-minded content questioning the dogma of Germ Theory and virology. 2/5/22

https://viroliegy.com/2022/02/05/who-you-gonna-call 

Mike Stone -For anyone tired of reading my words and for some reason desiring to hear me speak them out loud for 2 hours, this post is for you. I had the privilege of being on the Patrick Timpone show on One Radio Network yesterday to discuss the fraud known as virology. 2/23/22

https://viroliegy.com/2022/02/23/discussing-the-virus-lie-with-patrick-timpone/comment-page-1/#comment-1478 

In this episode, Alec Zeck has a discussion with Mike Donio, Jacob Diaz, Dr. Jordan Grant MD, and John Blaid on the fallacious reasoning, unproven assumptions, and lack of proof for virus theory. 2/25/22

https://www.bitchute.com/video/IWyynvrdRGUH 

Gatekeepers Keeping "Germ Theory" Alive By Promoting Notion Viruses Can Be Isolated 2/28/22

https://odysee.com/@CanuckLaw:8/Fake-Virus:8 

The same section of the Federal Food, Drug, and Cosmetic Act that authorizes the FDA to grant emergency use authorization also requires the secretary of Health and Human Services to “ensure that individuals to whom the product is administered are informed … of the option to accept or refuse administration of the product.”

https://www.statnews.com/2021/02/23/federal-law-prohibits-employers-and-others-from-requiring-vaccination-with-a-covid-19-vaccine-distributed-under-an-eua/ 

Mike Stone speaking with the Fakeologist about viroLIEgy as well as many other topics including the JFK assassination, the moon landing, the nuclear hoax, 9/11, and more. 3/5/22

https://fakeologist.com/blog/2022/03/03/fak488-mike-stone-of-viroliegy-com/ 

You can not sell the public on a “pandemic” without sensationalized propaganda aimed at generating massive amounts of fear. Without the initial terrifying headlines proclaiming the deadly toll this new “virus” took upon the Chinese citizens in Wuhan, would the rest of the world have believed in the existence of a “SARS-COV-2?” 3/7/22

https://viroliegy.com/2022/03/07/wheres-the-emergency/ 

ADDRESSING DR MCCULLOUGH, DR MALONE AND DR COLE'S SARS-COV-2 CLAIMS: WHERE'S THE EVIDENCE? Mike Donio, John Blaid, Jacob Diaz, Mike Stone, and Alec Zeck filmed a response to claims made by Dr. Peter McCullough, Dr. Robert Malone, and Dr. Ryan Cole regarding virus isolation and the existence of SARS-CoV-2 during an episode of The StreetMD 3/31/22

https://www.bitchute.com/video/9Mee0oHfBTGz/ 

Monkey Business 5/24/22

https://viroliegy.com/2022/05/24/monkey-business 

New Podcast: The Monkeypox Outbreak---Is It Real? 6/20/22

https://jonrappoport.substack.com/p/new-podcast-the-monkeypox-outbreak 

What exactly is a Covid death, according to the World Health Organization? What strict scientific and medical standards are applied in making such diagnoses?

https://yournews.com/2022/06/28/2367978/watch-video-what-the-who-defines-as-a-covid-death/ 

https://i.postimg.cc/QMh2fJqc/What-is-a-covid-death.jpg 

HFfH Podcast - Reversing Alzheimer's with Dr. Bill McGraw In this episode, Alec Zeck and Dr. Jess Peatross welcome back Dr. Bill McGraw to present the overwhelming evidence of the dangers of aluminum toxicity, its relation to Alzheimer’s disease, and the blatantly obvious cure – it’s all there in the data. 7/5/22

https://healthfreedomforhumanity.org/reversing-alzheimers-with-dr-bill-mcgraw/ 

Jon Rappoport “Stop arguing about the existence of the virus”

http://stateofthenation.co/?p=119598 

So why are people getting sick? Eric Coppolino 8/2/22

https://planetwavesfm.substack.com/p/so-why-are-people-getting-sick

Dandelions and Virology Eric Coppolino

https://planetwavesfm.substack.com/p/dandelions-and-virology

There are no respiratory viruses Mike Yeadon 8/3/22

https://www.facebook.com/mike.stone.54/videos/4656884074415015

https://rumble.com/v1ee8yv-dr-mike-yeadon-fraud-fear-and-how-herd-mentality-has-brought-us-to-the-edge.html

Song - It Began 8/22/22

https://www.youtube.com/watch?v=ycl93uOuRKs 

This is a rather long video with Poornima Wagh about the Jab, what's in it, how it affects your body, and why avoid it at all costs. She also provides a detained examination of each of the known Jabs...they are full of chemicals and particles that harm the body. If you feel overwhelmed because of the detail, fast forward to the last 30 minutes...but be sure to watch to the very end.8/25/22

https://www.bitchute.com/video/6uY601hwZIId/

Part 1 The Steve Kirsch debate about the existence of the virus

https://jonrappoport.substack.com/p/the-steve-kirsch-debate-about-the 

Part 2: The Steve Kirsch debate on the existence of the virus

https://jonrappoport.substack.com/p/part-2-the-steve-kirsch-debate-on 

Part 3 Jon Rappoport The Millionaire Blogger, in the Land of Virology  The man with money said he had a team of experts who would prove that these viruses existed. One virus in particular, would be the focus of the debate. Did it exist, or didn’t it? 9/6/22

https://zero-sum.org/the-millionaire-blogger-in-the-land-of-virology/ 

Part 4 Why Serious Scientific Debates Are Conducted In Writing, Not On-camera

https://jonrappoport.substack.com/p/why-serious-scientific-debates-are 

Explosive Lawsuit is One of First in the United States to Accuse Government of ‘Covid Fraud’ 9/4/22

https://beckernews.com/covid-fraud-46685/ 

Hospitals lied about numbers

https://www.joshwhotv.com/v/.GGM6 

Who are the quacks?

https://nla.gov.au/nla.obj-43775180/view?partId=nla.obj-43775692#page/n5/mode/1up 

OSHA

CAN OSHA MAKE YOU GET THE NEEDLE OR WEAR A MASK? Peggy Hall

https://youtu.be/FDRj6nfA1FA

OSHA must prove workplace danger 11/15/21

https://theconservativetreehouse.com/wp-content/uploads/2021/11/5th-circuit-filing-osha-1.pdf 

Vaccine mandate suspension

https://bioanalyticx.com/vaccine-mandate-suspension/ 

OSHA ON MY MIND Peggy Hall

https://youtu.be/i8wRlcYl_lU

Fifth Circuit Enjoins OSHA from Enforcing Mandatory Vaccination or Test Emergency Regulations

https://www.littler.com/publication-press/publication/fifth-circuit-enjoins-osha-enforcing-mandatory-vaccination-or-test 

OSHA Granted a stay to smaller court ruling

https://www.osha.gov/coronavirus/ets2 

Spacebusters videos

All video links

https://www.bitchute.com/channel/MKanl25dSUxl/ 

Steve and Billy Watson discuss The End of Germ Theory, Germ Theory for beginners, PCR nonsense, Antibody nonsense, the current Eddy Grand Solar Minimum, Phoenix events, hidden history, Agenda 21, what the elites are really up to behind the scenes, nano technology delivery systems and much more! 8/17/22

https://odysee.com/@spacebusters:c9/Bill-Watson-interview:3

Ep. 236 | Steve Falconer | The multi-trillion dollar germ theory and virus fraud 2/22/22

https://odysee.com/@adrianr:8/The_multi_trillion_dollar-germ_theory_and_virus_fraud:2 

VIRUS AND MRNA THEORY OFFICIALLY OVER! (WITH SLIDES) 2/22/22

https://www.bitchute.com/video/rloCSmKl8b4l/ 

Germs Debunk Corona The truth about ALL germs and the history of germ theory. Viruses aren't the only mythical unicorns out there.

https://www.bitchute.com/video/dg1D18lNImyS/

Cov-19 Immunity in 19 Minutes You will never "catch" a virus again after this. Ever.

https://www.bitchute.com/video/EdffVJbFxb96/ 

Virology Debunks Corona Germ theory, Covid 19 and the contagion myth thoroughly debunked and destroyed. Game over. Period. If you believe in viruses, mutated strains, herd immunity, 99.7% survival rate and any other such nonsense, you won't after you see this.

https://www.bitchute.com/video/YKktYdEGBRnP/ 

Biochemistry Debunks Corona Biochemistry proves you are afraid of and social distancing from yourself, not others. Germ "theory" destroyed.

https://www.bitchute.com/video/LGrc8KDrYCcK/ 

Hippocratic Hypocrisy By Dr Andrew Kaufman and Spacebusters...how health and medicine was hijacked and turned into selling sickness and poison for profit.

https://www.bitchute.com/video/ASmDEcEzhqo2/ 

There is NO proof that we are contagious to each other. All experimental attempts to prove so have been met with FAILURE, such as these, from 1919, archived by the CDC

https://www.bitchute.com/video/PAZL8bnPKp7i/ 

https://www.bitchute.com/video/7zBn96cmW06b/

NANO-MAN (DEEP NASAL SWAB TECH, RADIATION, INJECTION TECH, BORG ASSIMILATION) 1/26/22

https://www.bitchute.com/video/jDkn7ruUIFuj/ 

The article that got me banned from facebook

https://odysee.com/@northerntracey:a/articles:b 

Scripture

Ecclesiastes 1:9 What has been will be again, what has been done will be done again; there is nothing new under the sun. 

Revelation 22:18-19 I warn everyone who hears the words of the prophecy of this book: if anyone adds to them, God will add to him the plagues described in this book, and if anyone takes away from the words of the book of this prophecy, God will take away his share in the tree of life and in the holy city, which are described in this book.

Matthew 24:24 For false christs and false prophets will arise and perform great signs and wonders, so as to lead astray, if possible, even the elect.

When “isolation of a virus” is not the isolation Dr. Saeed Qureshi

Truth bombs

https://docs.google.com/document/d/e/2PACX-1vSfgnotjR3B-oEPrddFMvZpt359uVtJg5doUMO6eJIg8QyqX4OvzfeeBpx4w-e6eHTlVPTUo17bmioI/pub 

Dr. Saeed Qureshi is a retired Research Scientist from Health Canada, he has over 30 years of experience. His specialty is pharmacological safety, efficacy, and standards.

https://www.facebook.com/johnblaid/posts/4218363061512548 

https://docs.google.com/document/d/e/2PACX-1vRiCH1lUSnxieSSrkGBJuVEhJ3AwCNx8nU61DFh4YpNC3OnyU1i-lSFvOTKXWhNF75nNlSHS0ijXrYr/pub 

Virus isolation from India  – another false study! 7/11/22

https://bioanalyticx.com/virus-isolation-from-india-another-false-study 

Top Lab Test Expert: COVID-19 Virus ‘Does NOT Exist’

https://principia-scientific.com/top-lab-test-expert-covid-19-virus-does-not-exist/ 

DOCTOR SAED QURESHI REVEALS CORONAVIRUS HAS NOT BEEN ISOLATED - INTERVIEW 1/26/21

https://www.bitchute.com/video/ZiHh5v6e8Hzw/ 

COVID-19 Pandemic: This is not a virus/disease issue but of testing!

http://www.drug-dissolution-testing.com/?p=3482

Canadian public health officials have no record of SARS-COV-2 isolation/purification performed anywhere, ever Christine Massey, M.Sc.

https://peopleforjusticecanada.com/2021/01/05/canadian-public-health-officials-have-no-record-of-sars-cov-2-isolation-purification-performed-anywhere-ever/ 

COVID-19: The virus does not exist - it is confirmed! Saeed A. Qureshi, Ph.D

http://drug-dissolution-testing.com/blog/files/no-isolated-virus.pdf 

“Virus isolate” vs. “isolated virus” – an intentional misperception?

http://www.drug-dissolution-testing.com/?p=3613 

Regarding the claim of virus isolation, I am saying that the experiments microbiologists/virologists perform and describe, such as virus characterization, identification, belongs to the chemistry discipline. 1/6/21

http://www.drug-dissolution-testing.com/?p=3621 

CDC virus testing and isolation claims for SARS-CoV-2 and COVID-19: Non-scientific and pure illusion!

http://www.drug-dissolution-testing.com/?p=3548 

http://www.drug-dissolution-testing.com/blog/files/cdc-study-article-comments.pdf 

Science at the authorities – tests which do not test!

http://www.drug-dissolution-testing.com/?p=3526 

Isolation and characterization of the virus (SARS-CoV-2)

http://www.drug-dissolution-testing.com/?p=3533 

http://www.drug-dissolution-testing.com/blog/files/Virus-isolation-revised.pdf 

What does a positive coronavirus test really mean?

http://www.drug-dissolution-testing.com/?p=3557 

https://principia-scientific.com/discredited-cdc-sars-cov-2-covid-19-testing-isolation-claims/

International Pharmaceuticals Expert Exposes Pandemic Fakery!

https://principia-scientific.org/international-pharmaceuticals-expert-exposes-pandemic-fakery/

The science behind COVID and vaccines!

http://www.drug-dissolution-testing.com/?p=3574 

Discussion on the SARS-CoV-2 virus and its associated illness using scientifically invalid PCR test

http://www.drug-dissolution-testing.com/?p=3581 

SARS-CoV-2 (virus) and COVID-19 (disease) – Questionable Narrative!

http://www.drug-dissolution-testing.com/?p=3587 

COVID-19: Vaccine ‘Not Possible’ For A Virus Not Yet Quantifiable

http://www.drug-dissolution-testing.com/?p=3462 

https://principia-scientific.com/covid-19-vaccine-not-possible-for-a-virus-not-yet-identified/ 

Should FDA, and other authorities, approve the SARS-CoV-2/COVID-19 vaccines? – A scientific perspective

http://www.drug-dissolution-testing.com/?p=3567 

http://www.drug-dissolution-testing.com/blog/files/should-vaccine-approved.pdf 

Citizen Petition (FDA) – Requesting withdrawal of drug dissolution apparatuses from FDA regulatory requirements

http://www.drug-dissolution-testing.com/?p=3113 

I am correct, and they are wrong because the problem they are dealing with is not of medicine, virology, or epidemiology but chemistry. Virus isolation, characterization, testing, polymerization, and structure determination are part of chemical sciences or chemistry, and they have no training, even the basic one, in this subject. Given the opportunity, anyone with some reasonable chemistry expertise can find out about their false science and claims.

http://www.drug-dissolution-testing.com/?p=3605 

The FDA Committee's Review of Pfizer-BioNTech COVID-19 Vaccine: Unscientific, False and Deceitful

http://www.drug-dissolution-testing.com/?p=3591 

http://drug-dissolution-testing.com/blog/files/COVID-FDA-EAC.pdf

The science behind COVID and vaccines!

http://www.drug-dissolution-testing.com/?p=3574 

How to detect a shill or agent 2/1/21

https://www.youtube.com/watch?v=N9nQYKhd1Jo&feature=youtu.be 

Virus isolation

https://i.postimg.cc/nz3yZ931/Isolation.jpg 

Reply: Isolating or extracting something means separating it from other components usually present in the natural environment. It is a standard process or practice to obtain a purified component for further study or larger use. For example, most, if not all, metals such as gold, copper, uranium are isolated/extracted from their ores. The process of isolation may be explained as follows. If one takes sugar cane, crushes it, squeezes it to get the juice out, and then concentrates it by boiling. Leaving the concentrate at room temperature will result in the crystallization of sugar as pure white particles. Thus, the process would be called the isolation of sugar from sugar cane. Concerning the virus, it means that the virus has been separated from the content of the swab sample. In the end, the virus as particles should be available in a test tube or vial. This purified specimen should be used to develop test methods, study illness, and develop treatments, including vaccines. Unfortunately, this isolation part for the virus has never been done. Hence no pure isolated specimen is available. Therefore, neither tests for the virus can be developed nor the treatments, including vaccines.

https://bioanalyticx.com/isolating-a-virus/

Claims of a novel virus No scientific proof Covid virus has ever been isolated,

Separation and purification, in chemistry, separation of a substance into its components and the removal of impurities.

https://www.britannica.com/science/separation-and-purification 

Here is another proof of how virologists deceive themselves. Virologists did not sequence the "virus" but sequenced an organism called a "human lung metagenome" This is a scientific fact and anyone can check what is stated in the public database: This means that virologists did not isolate the "virus".

https://trace.ncbi.nlm.nih.gov/Traces/study/?acc=SRP245409&o=acc_s%3Aa

https://www.ncbi.nlm.nih.gov/biosample/SAMN13922059

John F. Enders is a very important player in the history of virology. He changed how they use the word isolation. It no longer means it's literal definition. Not only that but he was aware that his viral culture didn't prove virus and yet he allowed this method to continue being used. The history of virology is rampant with fraud.

https://i.postimg.cc/rmSrS0xV/John-Enders-created-the-modern-virus-isolation-method.jpg 

CDC admits that if we use the  definition of “isolation”, it is outside of what is possible in virology. So the CDC says microbiology came up with a “new” definition of “isolation” that includes culturing in cell cultures. 3/22/21

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/03/CDC-March-1-2021-SARS-COV-2-Isolation-Response-Redacted.pdf 

DR STEFAN LANKA DEBUNKS PICTURES OF “ISOLATED VIRUSES

https://www.vaccinationinformationnetwork.com/dr-stefan-lanka-debunks-pictures-of-isolated-viruses 

They didn’t isolate the virus Dr Wuzunyou Chinese CDC NDC interview

https://i.postimg.cc/FFYrHpSW/They-didnt-isolate-the-virus-Dr-Wuzunyou-Chinese-CDC.jpg 

There are many things that are wrong with the claim of isolation of "viruses" and the use of cell cultures to prove the existence of "viruses". 3/7/21

https://docs.google.com/document/d/e/2PACX-1vSIbRrAPqiClh_D00318bV9yPnK5YbnVlvie_c8IpEtsC1tnoNrqCVJIyzl_DIptLlYrId0FFX_cGUf/pub 

Here are 3 compilation pdfs containing ~70 responses from 53 institutions in 11+ countries/jurisdictions re the isolation/purification/existence of “SARS-COV-2” last updated April 9, 2021 4/20/21

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/02/FOI-replies-SARS-COV-2-isolation-existence-causation-47-institutions-Feb-12-2021-chrono-part-1.pdf 

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/02/FOI-replies-SARS-COV-2-isolation-existence-causation-47-institutions-Feb-12-2021-chrono-part-2.pdf 

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/04/FOI-replies-SARS-COV-2-isolation-purification-existence-part-3-April-3.pdf 

People can also visit this page by Christine Massey to be up to date with all of these challenges and their respective responses.

https://www.fluoridefreepeel.ca/fois-reveal-that-health-science-institutions-around-the-world-have-no-record-of-sars-cov-2-isolation-purification

https://thevirushoax.atlassian.net/wiki/download/attachments/294913/FOI-responses-re-covid19-virus-isolation-purification-from-33-institutions-Nov-7-2020-reordered.pdf

The Freedom of Information Act (FOIA) is a federal statute that allows individuals to request access to federal agency records, except to the extent records are claimed as exempt from disclosure under one or more of the nine (9) exemptions of the Freedom of Information Act.

https://www.hhs.gov/foia/index.html 

CDC March 1st FOIA reply to Michael S On March 1, 2021 once again the CDC made clear that they still have no records of “SARS-COV-2” isolation performed by anyone, anywhere on the planet, ever… just not in so many words. Instead, the CDC absurdly implied that isolation of “SARS-COV-2” would require the replication of a “virus” without host cells and thus is impossible. 3/4/21

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/03/CDC-March-1-2021-SARS-COV-2-Isolation-Response-Redacted.pdf 

The Virus Theory has been around for more than a century.  The pharmaceutical industry and in particular the vaccination industry is founded on the basis that virus exist and cause illness.  This website exposes the hoax and the pseudo-science on this failed theory.

https://thevirushoax.atlassian.net/wiki/spaces/VIRUS/pages/294913/The%2BVirus%2BHoax 

I have sent many Freedom & Official Information Act Requests for the isolation of SARS-COV-2.  Not a single organization responded with any records.Critics could say that the question is invalid and that it's impossible to isolate anything as described. So I decided to challenge my critics by sending a new request; maintaining the exact same language but replacing SARS-COV-2 with human exosome. This document details the response that I have received

https://thevirushoax.atlassian.net/wiki/spaces/VIRUS/pages/140574726/Human+Exosome+Isolation 

Marc Horn all Freedom of Information requests (approximately 52) 11/2/20

https://www.whatdotheyknow.com/user/marc_horn 

FOI Request UK Cabinet Office Viruses are different in that they are what we call “obligate pathogens” – that is,   THEY CANNOT SURVIVE OR REPRODUCE WITHOUT INFECTING A HOST how then can the they transmitted from one to another...how can they be contagious?

https://www.facebook.com/groups/germtheory.vs.terraintheory/permalink/3747684331975214 

We developed a test without virus material available 12/1/20

https://i.postimg.cc/KjZXfJvH/Drosten-paper.jpg 

FOI response from KFL&A Public Health (Ontario, Canada) where Dr. Kieran Moore is warning that "variants" have been detected: no record describing the isolation of any "SARS-COV-2 variant" old or new, by anyone, anywhere on the planet, ever. 2/25/21

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/02/KFLA-FOI-no-records-of-isolation-of-any-variant-Feb-21-2021.pdf

FOI response from the CDC dated December 30, 2020 re the alleged 2003 “SARS-COV-1” and all “common cold coronaviruses” – the CDC has no record of any having been isolated.  Here is a temporary pdf of the redacted letter…. a better pdf one will follow:

https://www.fluoridefreepeel.ca/wp-content/uploads/2020/12/CDC-isolation-FOI-reply-any-coronavirus.pdf 

Health Canada no record of isolation

https://www.fluoridefreepeel.ca/health-canada-has-no-record-of-covid-19-virus-isolation/ 

The Dept. of Health and Social Care is requested to provide evidence of its purported, alleged pathogenic virus (SARS-CoV-2) 11/3/20

https://www.whatdotheyknow.com/request/679704/response/1666239/attach/4/IR%201243364.pdf 

https://www.whatdotheyknow.com/request/full_accurate_and_complete_discl_5 

FOI reveals Ontario Ministry of Health has no record of SARS-COV-2 isolation by anyone, anywhere, ever 1/26/21

https://www.fluoridefreepeel.ca/foi-reveals-ontario-ministry-of-health-has-no-record-of-sars-cov-2-isolation-by-anyone-anywhere-ever/

The Smoking Gun: Where is the coronavirus? The CDC says it isn’t available 10/8/20

https://blog.nomorefakenews.com/2020/10/08/the-smoking-gun-where-is-the-coronavirus-the-cdc-says-it-isnt-available 

The CDC is admitting the virus hasn’t been isolated. In other words, its existence is unproven.

https://blog.nomorefakenews.com/2020/10/09/covid-the-virus-that-isnt-there-the-root-fraud-exposed/ 

COVID19 Is Really A CDC Computer-Generated ‘Virus 11/2/20

https://principia-scientific.com/revealed-covid19-is-really-a-cdc-computer-generated-virus/ 

The rules for isolation of a retrovirus were thoroughly discussed Pasteur Institute, Paris,1973

http://www.virusmyth.com/aids/award.htm

Why “virus isolation is NOT recommended as a routine diagnostic procedure”... probably because you’d find that it wasn’t possible! 11/3/20

https://apps.who.int/iris/rest/bitstreams/1272454/retrieve

How to scientifically prove a new disease

https://i.postimg.cc/Dy88T6SR/How-to-scientifically-prove-new-disease.jpg 

6 Steps of the Scientific Method

https://www.thoughtco.com/steps-of-the-scientific-method-p2-606045

If the ‘novel Coronavirus’ is proven to exist, regulators must then publish evidence showing how this ‘novel Coronavirus’ fulfils Koch’s postulates before it can be assumed that it causes the ‘new’ disease recently termed ‘Covid-19’.

https://theinfectiousmyth.com/coronavirus/EvidenceExistenceCOVID19Corbett.pdf

Dr Cowan - Explaining The False Claims Of Isolation & Purification - Covid19 10/9/20

https://www.youtube.com/watch?v=LUP4rTyO11o&feature=youtu.be 

Why don’t Bhakdi and co. conduct the required control experiments as requested by Dr. Stefan Lanka, among others? 9/3/20

https://thdrussell.blogspot.com/2020/09/open-appeal-to-virologists-from.html 

Leading corona researchers admit that they have no scientific evidence for the existence of a virus

https://telegra.ph/Alle-f%C3%BChrenden-Wissenschaftler-best%C3%A4tigen-COVID-19-existiert-nicht-07-03 

CDC admits page 39 No quantified virus isolates of the 2019-nCoV are currently available

https://www.fda.gov/media/134922/download 

FDA QUIETLY REVEALS THAT COVID-19 HAS NOT BEEN ISOLATED 8/27/20

https://www.bitchute.com/video/zrmV5qd2dHA/ 

Prof. M. Tanner If a SARS-COV2 isolate cannot be documented, we have a problem 9/19/20

https://www.youtube.com/watch?v=TQRbxZy-8FE&feature=youtu.be 

“No need to isolate the new virus, we have its genetic sequence”: Really? 8/25/20

https://blog.nomorefakenews.com/2020/08/25/no-need-to-isolate-new-virus-we-have-its-genetic-sequence/ 

Australia’s Doherty Institute claimed to have isolated the “COVID-19 virus” aka “SARS-COV-2”, later said they have no record of such

https://www.fluoridefreepeel.ca/australias-doherty-institute-claimed-to-have-isolated-the-covid-19-virus-aka-sars-cov-2-later-said-they-have-no-record-of-such/

Australia’s Commonwealth Scientific and Industrial Research Organization which is involved in “COVID-19” vaccine trials using the so-called “SARS-COV-2 isolate” from Doherty Institute:

https://www.fluoridefreepeel.ca/wp-content/uploads/2020/10/CSIRO-Isolation-Response-scrubbed.pdf

Page 6 'RT-PCR detects the presence of viral genetic material in a sample but is not able to distinguish whether an infectious virus is present.' Ergo, it is not capable of diagnosis. 10/30/20

https://www.gov.uk/government/publications/cycle-threshold-ct-in-sars-cov-2-rt-pcr 

U.K. Department of Health and Social Care has no record of “COVID-19 virus” isolation"

https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-of-covid-19-virus-isolation 

Public Health England no record of “COVID-19 virus” isolation"(note that this response was obtained by Andrew Johnson “a Technology Tutor at a UK University“): https://www.whatdotheyknow.com/request/679566/response/1625332/attach/html/2/872%20FOI%20All%20records%20describing%20isolation%20of%20SARS%20COV%202.pdf.html

This is Andrew’s write-up on his FOI request: https://cvpandemicinvestigation.com/2020/08/phe-has-no-real-evidence-that-sars2-cov2-causes-covid-19-chromosome-8-blood-plasma-treatment-and-more/.

New Zealand: the Ministry of Health and the Institute of Environmental Science and Research have no record of “COVID-19 virus” isolation (anywhere, ever)

https://www.fluoridefreepeel.ca/new-zealand-no-record-of-covid-19-virus-isolation-at-the-ministry-of-health-or-the-institute-of-environmental-science-and-research/

Canada’s Vaccine and Infectious Disease Organization – International Vaccine Centre has no record of “COVID-19 virus” isolation

https://www.fluoridefreepeel.ca/canadas-vido-intervac-has-no-record-of-covid-19-virus-isolation 

McGill University FOI request and has no record of “COVID-19 virus” isolation from anywhere in the world 10/25/20

https://truthseeker.se/wp-content/uploads/2020/10/FOI-request-McGill.pdf 

Region of Peel in Canada responds to FOI request and has no record of “COVID-19 virus” isolation from anywhere in the world

https://www.fluoridefreepeel.ca/region-of-peel-has-no-record-of-covid-19-virus-isolation/ 

University of Toronto have no record of “COVID-19 virus” isolation

https://www.fluoridefreepeel.ca/university-of-toronto-sunnybrook-hsc-have-no-record-of-covid-19-virus-isolation/ 

Sunnybrook HSC have no record of “COVID-19 virus” isolation

https://www.fluoridefreepeel.ca/wp-content/uploads/2020/07/Sunnybrook-SKM_C36820071417011.pdf 

McMaster University we have found no responsive records to your request

https://www.fluoridefreepeel.ca/wp-content/uploads/2020/08/McMaster-2020-GR-10-DECISION-LETTER.pdf 

Sinai Health has no record of Covid Isolation from anywhere in the world

https://www.fluoridefreepeel.ca/wp-content/uploads/2020/08/Mnt-Sinai-2020-08-25-FOI-Request-20-03-Response-Letter-to-Requester.pdf 

Health 19 has no record of Covid Isolation from anywhere in the world

https://www.fluoridefreepeel.ca/health-canada-has-no-record-of-covid-19-virus-isolation/

NRC of Canada has no record of Covid Isolation from anywhere in the world.

https://www.fluoridefreepeel.ca/wp-content/uploads/2020/07/NRC-A2020-0010-Response-NIL.pdf

Australian Government Department of Health has no record of a “COVID-19 virus” isolated from any human on the planet  8/29/20

https://www.fluoridefreepeel.ca/australian-dept-of-health-has-no-record-of-covid-19-virus-isolation/

New Zealand’s Associate Ministers of Health Peeni Henare has “no records”:

https://www.fluoridefreepeel.ca/wp-content/uploads/2020/10/Hon-Peeni-Henare-Response-scrubbed.pdf

New Zealand’s Associate Ministers of Health Julie Anne Genter has “no records”:

https://www.fluoridefreepeel.ca/wp-content/uploads/2020/10/Hon-Julie-Anne-Genter-Response-scrubbed.pdf

Australia’s Department of Health: no record of isolation

https://www.fluoridefreepeel.ca/australian-dept-of-health-has-no-record-of-covid-19-virus-isolation/

“The Statens Serum Institut can state that we have now carried out a journal search for documentation that has convinced the Statens Serum Institut about the real existence of SARS-CoV-2, the alleged cause of COVID19 and moreover, we have in some other way tried to locate relevant documents. Statens Serum Institut can note that we are not in possession of the requested documents...”

https://www.fluoridefreepeel.ca/wp-content/uploads/2020/10/Denmark-The-Statens-Serum-Instituttet-SARS-COV-2-FOI-reply-Afgoerelse_Alex_Holmstedt_SAG_20-08162__1_.pdf

Wuhan - We did not perform test for infectious virus in the body

https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30183-5/fulltext

Our study does not fulfill Kochs Postulates

https://www.nejm.org/doi/full/10.1056/NEJMoa2001017 

COVID: Did they actually discover a new coronavirus? The question won’t go away.  

https://www.sgtreport.com/2020/08/covid-did-they-actually-discover-a-new-coronavirus-the-question-wont-go-away/

Why didn’t researchers do a proper study to discover whether the COVID virus exists? 8/27/20

https://blog.nomorefakenews.com/2020/08/26/no-proper-study-to-discover-if-covid-virus-exists/ 

Define the variables. None of this is done in "virus" experiments

http://www2.lv.psu.edu/jxm57/irp/var.htm

So why exactly did we start believing in germs and 'viruses' (and nature became the enemy)?

https://www.discerningreality.com/post/so-why-exactly-did-we-start-believing-in-germs-and-viruses-and-nature-became-the-enemy 

Yes people are getting sick, but it’s not from the unproven covid disease

https://i.postimg.cc/KjyM71Xv/What-causes-disease.jpg 

This case indicates how anaphylaxis may mimic symptoms caused by SARS-CoV2 12/9/20

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7395240/ 

Why are people getting sick if its not from Covid

https://i.postimg.cc/HkCxPZ7j/Why-are-people-getting-sick-if-its-not-from-Covid.jpg 

COVID-19 PM2.5 Exposure to air pollution and COVID-19 mortality in the United States

https://projects.iq.harvard.edu/covid-pm/home

Do viruses fly acrolein does in PM25 airborne pollution that can circle the globe in a number of days and seeing that it is ubiquitously present in everyone's environment 24/7

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2423340 

Disease Is Body Action And Is Self-Limiting

https://www.rawfoodexplained.com/contagion-epidemics/disease-is-body-action-and-is-self-limiting.html 

Toxic Substances Portal - Hydrogen Cyanide (HCN) It can cause symptoms similar if not the same as COVID-19 symptoms, such as coughing, hypoxia, lung and kidney damage 8/20/20

https://www.atsdr.cdc.gov/MMG/MMG.asp?id=1141&tid=249

THE INVENTED PANDEMIC, the lack of VIRUS ISOLATION the INVALID COVID test 9/19/20

https://www.facebook.com/notes/stefano-scoglio/the-invented-pandemic-the-lack-of-virus-isolation-and-the-invalid-covid-19-test/10219132803013133/ 

“It is the right and duty of every citizen to see what the scientists have said and to analyse it for themselves.”The evidence - Evidence Not Fear 9/30/20

httpshttps://jasn.asnjournals.org/content/31/9/2223://evidencenotfear.com/evidence/

Caution in Identifying Coronaviruses by Electron Microscopy 10/13/20

https://jasn.asnjournals.org/content/31/9/2223 

Covid does not exist for 2 reasons

https://i.postimg.cc/TP6ZJkTf/Covid-does-not-exist-for-2-reasons.jpg 

Cells Can Replicate Their DNA Precisely

https://www.nature.com/scitable/topicpage/cells-can-replicate-their-dna-precisely-6524830

The rules for isolation of a retrovirus were thoroughly discussed at the Pasteur Institute, Paris, in 1973, and are the logical minimum requirements for establishing the independent existence

http://www.virusmyth.com/aids/award.htm 

Psst, the human genome was never completely sequenced as claimed 10/27/20

https://www.statnews.com/2017/06/20/human-genome-not-fully-sequenced 

As No Physical Sample Of The Virus Is Available, Let Us ‘Create’ The Virus From RNA Found In The Patient’s Swab Samples And Which We Presume To Be RNA From SARS-CoV-2 Virus. 11/12/20

https://principia-scientific.com/discredited-cdc-sars-cov-2-covid-19-testing-isolation-claims/ 

Covid logic test

https://i.postimg.cc/XNh4F9wn/Covid-19-logic-test.jpg 

Dr Jordan Grant No proof of isolation of covid 11/18/20

https://i.postimg.cc/nhF8XkY5/No-isolates.jpg 

Bottom Line virus isolation and circular reasoning Dr Jordan Grant 11/18/20

https://i.postimg.cc/BQYhjCKg/Bottom-Line-on-isolation.jpg 

The only way they have to detect and sequence "novel viruses" is through references to other similar "viruses" in databases. a purified "virus" is absolutely necessary in order to get a full genome. 12/11/20

https://mbio.asm.org/content/5/3/e01360-14 

COVID-19 (excess) mortalities: viral cause impossible—drugs with key role in about 200,000 extra deaths in Europe and the US alone 12/22/20

https://realnewsaustralia.com/2020/10/01/covid-19-excess-mortalities-viral-cause-impossible-drugs-with-key-role-in-about-200000-extra-deaths-in-europe-and-the-us-alone/ 

Global perspective of COVID‐19 epidemiology for a full‐cycle pandemic 12/22/20

https://onlinelibrary.wiley.com/doi/10.1111/eci.13423 

200,000 US dollars and counting. It will be awarded by @eckert_official to the one who can present proof of the Coronavirus isolates as per the scientific method. 12/28/20

https://twitter.com/code__green/status/1342763097451184128 

No proof of purified/isolated virus that meets Kochs Postulates

https://m.facebook.com/story.php?story_fbid=10157773595893576&id=502548575&ref=m_notif&notif_t=group_r2j_approved 

CHINA ADMITS THE BIGGEST LIE they didn’t isolate the virus 1/31/21

https://www.youtube.com/watch?v=w24g5zj__qo&feature=youtu.be 

http://www.thepeoplesvoice.org/TPV3/Voices.php/2021/02/17/they-didn-t-isolate-the   

Let's examine the official claims of the initial SARSCVD19 isolation in China. You literally don't even have to get past the first paragraph You will find that they admit in their own report that they have not isolated anything.

https://www.cell.com/trends/pharmacological-sciences/fulltext/S0165-6147(20)30129-2 

Is complete purification/isolation of a "virus" even possible?

https://docs.google.com/document/d/e/2PACX-1vTx9BIQAwWZm7gi6v1_w9T_tWyknOEuRx8kCJVJ7tN_dcYUc8EwsF92AShh3HwmDOxLDVDd417jWjzO/pub 

Dr. Lanka points out, in principle you only need to understand the basics of the methodology. Rhinoviruses go back to Dr. Winston H. Price, who is said to have discovered and isolated them in 1956. However, the experiments are the same that Dr. Lanka found in all publications of so-called disease-causing viruses. Here is the excerpt from the methodology. Look for monkey kidney cells, Hela cells (Henriette Lacks) CPE and at the end "the statement of these observations is not clear at the present time."

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC528365/pdf/pnas00715-0006.pdf 

Mike Adams Ad-hoc 15 - Where to find the isolate? 8/18/21

https://odysee.com/@Corona.../Ad-hoc_15_english_title:6

Germ Theory: The greatest lie ever told

https://www.youtube.com/watch?v=bIpJ2J61SGU 

Purification of a "virus" is impossible 3/16/21

https://docs.google.com/document/d/e/2PACX-1vTjyUqE8tA2J7hdxTrmdgsa5o8EOR2DjAI08i52V6X_gAyHA6vMNas3dRwgm10FmYM12JKWeTrmyXUs/pub 

All links combined

https://docs.google.com/document/d/e/2PACX-1vQpID4UPOeRDf32raDlmSGV8KRNXWcA6dAF6vNdD_Jb9YC8oOjcW837Ub13MWc0WqTgwABZhLpcXuIy/pub 

Coronavirus Papers

Authors of 4 main studies on covid admit no purified virus

https://i.postimg.cc/ryx9dQpy/Authors-of-scientific-papers-admit-no-purified-virus.jpg

Document looking at the different coronavirus papers

https://docs.google.com/document/d/e/2PACX-1vTCTJaZOpHk-OtFNIspUMha6AsXQVVSoEggOkpoCcFOmhyetd9JNUay4L_OWQR6QyeP7vGhE1L-Q7SN/pub 

Christine Massey

FOIA requests

https://www.fluoridefreepeel.ca/fois-reveal-that-health-science-institutions-around-the-world-have-no-record-of-sars-cov-2-isolation-purification/ 

Christine Massey has to appear in Court in Peterborough, Ontario, to satisfy a warrant for her arrest on BOGUS criminal charges arising from her public service work. 6/30/22

https://apocalypticyoga.substack.com/p/you-are-my-hero-christine-massey 

Christine Massey:can CV19 isolation records be found? 5/16/22

https://odysee.com/@FREEDOMUFOS:8/Christine-Massey-on-DTV-05-05-2022:3 

My “open exchange” with Michael Yeadon, May 28, 2022

https://www.fluoridefreepeel.ca/my-open-exchange-with-michael-yeadon-may-8-2022

Interview with Mike Adams No Virus Isolation Massey 5/4/22

https://odysee.com/@R.A.I.N.:0/Mike-Adams-05.04.2022---No-Virus-Isolation-Massey:5 

Response to Mercola 1/18/22

https://www.fluoridefreepeel.ca/open-letter-to-dr-mercola-january-17-2022 

https://snooze2awaken.com/2022/01/24/a-blistering-open-letter-to-unscientific-germ-theorist-dr-joseph-mercola-on-the-still-unproven-virus-by-christine-massey-m-sc/ 

Open Letter to Steve Kirsch 6/15/22

https://www.fluoridefreepeel.ca/open-letter-to-steve-kirsch-january-10-2022 

Germany/BavPat1/2020 is not isolated “virus”, and it has never been shown to have anything to do with a “virus”. Germany/BavPat1/2020 is just more Corman/Drosten monkey-business fraud.

https://www.fluoridefreepeel.ca/muc-1-aka-muc-imb1-just-more-corman-drosten-monkey-business-fraud/ 

Human 2019-nCoV Isolate

https://www.european-virus-archive.com/virus/human-2019-ncov-isolate 

Notice: Trespass and Liability CEASE AND DESIST ALL “COVID-19” INTERFERENCE AND PROPAGANDA 1/19/22

https://www.fluoridefreepeel.ca/wp-content/uploads/2022/01/Trespass-Notice-to-Thomas-Piggott-Jan-19-2022.pdf 

Interview with Christine Massey and ADV 12/16/21

https://yummy.doctor/video-list/interview-with-christine-massey-and-adv 

This week's podcast episode features an interview with Christine Massey. She will discuss how she used Freedom of Information requests to ask for proof of virus isolation from many "health" organizations like the CDC. 1/12/22

https://www.bitchute.com/video/fBN2S8mR6ipP

This link will take you to a google drive folder where all of the documents as of October 7, 2021 are publicly available and GROUPED BY COUNTRY (for the most part):

https://tinyurl.com/IsolationFOIs

Christine Massey reveals to Mike Adams (Health Ranger) Covid-19 "virus" has never been isolated and shown to cause disease | She apparently asked via FOIA requests about isolation of other viruses - no proof of isolation for any those viruses. 12/7/21

https://odysee.com/@WakeUpMirror:3/CM-MA-VNI:0 

Christine Massey: SARS-COV-2 Not Proved to Exist, Virology Not a Science | Open Info Wars with Journalists & Scientists 1/24/22

https://odysee.com/@RamolaDReports:8/Report_277___Christine_Massey__SARS_COV_2_not_proved_to_exist__Virology_not_a_science__Open_Letters:d 

Covid: No Record Found Of SARS-CoV-2 11/22/21

https://www.westonaprice.org/podcast/covid-no-record-found-of-sars-cov-2/ 

Christine Massey and Michel Chossudovsky. Does the Virus Exist. Has SARS-CoV-2 Been Isolated 8/20/21

https://www.globalresearch.ca/does-the-virus-exist-has-sars-cov-2-been-isolated-interview-with-christine-massey/5753322 

It’s All About the “Case” Numbers – interview with Christine Massey 8/20/21

https://newellmediagroup.com/wp/?p=6886 

Atlantic Underground Podcast Episode #64 Guests (Patrick King and Christine Massey) 8/23/21

https://odysee.com/@AtlanticUndergroundPodcast:6/Atlantic-Undeerground-Podcast-Episode--64-zoom_0:9 

Imaginary “monkeypox viruses” – resources 6/20/22

https://www.fluoridefreepeel.ca/monkeypox/ 

Here are 8 compilation pdfs containing FOI responses from 105 institutions in >20 countries/jurisdictions, re the isolation/purification/existence of “SARS-COV-2”, as well as emails from authors of studies that claimed to have “isolated the virus” and an email from the Head of the Consultant Laboratory for Diagnostic Electron Microscopy of Infectious Pathogens at Germany’s Robert Koch Institute (note: many of these responses were obtained by FOI-submitters other than Michael S. and myself, as indicated further down this page):

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/02/FOI-replies-SARS-COV-2-isolation-existence-causation-47-institutions-Feb-12-2021-chrono-part-1.pdf

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/02/FOI-replies-SARS-COV-2-isolation-existence-causation-47-institutions-Feb-12-2021-chrono-part-2.pdf

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/04/FOI-replies-SARS-COV-2-isolation-purification-existence-part-3-April-3.pdf

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/06/FOI-replies-re-SARS-COV-2-purification-existence-June-3-2021-part-4.pdf

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/07/FOI-replies-re-SARS-COV-2-purification-existence-July-13-2021-part-5.pdf

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/08/FOI-replies-re-SARS-COV-2-isolation-existence-causation-Aug-15-2021-part-6.pdf

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/08/FOI-replies-re-SARS-COV-2-isolation-existence-causation-Aug-27-2021-part-7.pdf

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/09/FOI-replies-re-SARS-COV-2-isolation-existence-causation-Sept-29-2021-part-8-compressed.pdf

Click here to see an Excel file listing the institutions (last updated October 19, 2021):

https://www.fluoridefreepeel.ca/wp-content/uploads/2021/10/Institution-list-for-website5.xls

THE DISRUPTION CORONA PRESS CONFERENCE ...THE MISSING VIRUS [SARS-COV-2]… 10/25/21

https://www.bitchute.com/video/AiwB5h4VCnTH/ 

FOI Request

Proof of the Covid-19 virus - a Freedom of Information request to Prime Minister's Office  

https://www.whatdotheyknow.com/request/proof_of_the_covid_19_virus 

ROCCO GALATI - STÉPHANE BLAIS - COVID-19 AND GOVERNMENT ABUSES

https://www.youtube.com/watch?v=ghka1b3aPVk&feature=youtu.be

Letter to Local Council Regarding a "COVID-19 Update"

https://miriaf.webs.com/going-viral

Bartholomeus Lakeman made this Freedom of Information request to Prime Minister's Office

https://www.whatdotheyknow.com/request/proof_of_the_covid_19_virus

JAN interactive: Problems with current UK government lockdown policy

http://journalofadvancednursing.blogspot.com/2020/04/problems-with-current-uk-government.html

Citizen inquiries (Part 1): RKI openly admits its ignorance

https://telegra.ph/B%C3%BCrgeranfragen-RKI-gibt-Ihre-Ahnungslosigkeit-offen-zu-08-12

The Alberta Government is accepting public feedback on the Public Health Act.

http://www.assembly.ab.ca/Announcements/NewsReleases/2020/PHAR2020_NewsRelease.pdf

If there's no proof the virus exists end all Lockdowns/Masks/Trax/Vax actions  

https://www.gopetition.com/petitions/if-theres-no-proof-the-virus-exists-end-all-lockdownsmaskstraxvax-actions-2.html

No deaths of frontline officers due to coronavirus

https://www.met.police.uk/SysSiteAssets/foi-media/metropolitan-police/disclosure_2020/may_2020/information-rights-unit---police-officer-deaths-due-to-the-coronavirus 

Woman To Palm Beach County Representatives: "You Have Been Served For Treason!"  9/6/20

https://sonsoflibertymedia.com/woman-to-palm-beach-county-representatives-you-have-been-served-for-treason/

Mike Stone blog

The Testing Pandemic: Conspiracy No More 3/13/22

https://viroliegy.com/2022/03/13/the-testing-pandemic-conspiracy-no-more/ 

Brecht Arnaert interviews Michael Wallach and Mike Stone: "Why virology is a pseudo-science" Micheal talks about wife's misdiagnosis of arthritis. 4/6/22

https://www.youtube.com/watch?v=CrdUzcpLwgw 

Gain of Fiction What must be realized about the GOF studies and the bioweapon narrative is that these stories are designed to keep people believing in the lies of Germ Theory. This is yet another fear-based tactic utilized by those in power to ensure that the masses are frightened of an invisible enemy that can be unleashed upon the world either accidentally or intentionally at a moments notice. There will be figureheads who appear to be on the side of truth, questioning the natural existence of “SARS-COV-2,” challenging the safety of the vaccines, promoting alternative therapies, etc. who will also continue to push the idea that “viruses” exist and can be manipulated in a lab. These people are the Pied Pipers leading those who are going astray back into the fold. There is no need to create a “virus” bioweapon when all that was needed to control the masses is a PCR test and some well-designed propaganda. 4/6/22

https://viroliegy.com/2022/04/07/gain-of-fiction 

Monkeypox Party With Patrick Timpone 5/26/22

https://viroliegy.com/2022/05/26/monkeypox-party-with-patrick-timpone/

The case against rabies 8/3/22

https://viroliegy.com/2022/08/03/blindsided-by-rabies-with-michael-wallach-on-the-skeptico-podcast 

DR MALONE AND DR COLE'S SARS-COV-2 CLAIMS: WHERE'S THE EVIDENCE? Response to several Drs. who still are claiming vivid exists. Breakdown point by point.

https://www.bitchute.com/video/9Mee0oHfBTGz 

Mike Stone speaking with the Fakeologist about viroLIEgy as well as many other topics including the JFK assassination, the moon landing, the nuclear hoax, 9/11, and more.

https://fakeologist.com/blog/2022/03/03/fak488-mike-stone-of-viroliegy-com/

Mike Stone -For anyone tired of reading my words and for some reason desiring to hear me speak them out loud for 2 hours, this post is for you. I had the privilege of being on the Patrick Timpone show on One Radio Network yesterday to discuss the fraud known as virology.

https://viroliegy.com/2022/02/23/discussing-the-virus-lie-with-patrick-timpone/comment-page-1/#comment-1478

Mike Stone on the virology lie. 6/2/22

https://jermwarfare.com/podcast/mike-stone 

Back in the Trenches With Jerm Warfare and Mike Stone 6/12/22

https://viroliegy.com/2022/06/11/back-in-the-trenches-with-jerm-warfare/ 

Purification: Virology’s Black Sheep 6/16/22

https://viroliegy.com/2022/06/16/purification-virologys-black-sheep

I have written many articles on the inability to completely purify and isolate exosomes from “viruses” and other particles of similar size and density. This is a fundamental problem for exosome and “viral” research as without being able to separate the particles assumed to be exosomes from those claimed to be “viruses,” there is no way to be able to study either independently, distinguish them from any of the other particles, nor to characterize the particles properly.

https://viroliegy.com/2022/06/27/the-exosome-concept 

Dissecting “Viruses” and Grapefruits with Eric Coppolino 7/22/22

https://viroliegy.com/2022/07/24/dissecting-viruses-and-grapefruits-with-eric-coppolino/

Rabies: The “Virus” of Fear 8/8/22

https://viroliegy.com/2022/08/08/rabies-the-virus-of-fear/

Effects of Lockdowns

 A Critical Review of CDC USA Data on Covid-19: PCR/Antigen Tests and Cases Reveal Herd Immunity Only and Do Not Warrant Public Hysteria or Lockdowns 3/11/21

https://www.researchgate.net/publication/348550612_A_Critical_Review_of_CDC_USA_Data_on_Covid-19_PCRAntigen_Tests_Cases_Reveal_Herd_Immunity_Only_Do_Not_Warrant_Public_Hysteria_or_Lockdowns 

Supplementary Information for "A Critical Review of CDC USA Data on Covid-19" by J. DeMeo

https://www.researchgate.net/publication/348894789_Supplementary_Information_for_A_Critical_Review_of_CDC_USA_Data_on_Covid-19_by_J_DeMeo 

NATIONAL BUREAU OF ECONOMIC RESEARCH has published a paper that attempts to discover some impact of government mandates on virus transmission and death. The authors find none. 11/19/20

https://www.nber.org/system/files/working_papers/w27719/w27719.pdf 

https://www.nber.org/papers/w27719

Overall all-cause death numbers did not increase in 2020 in the US. Inexplicable drops in death rates by the usual conditions such as heart disease were precisely matched by a compensatory number of “covid deaths,” effectively canceling each other out. 12/3/20

https://brendandmurphy.com/censored-study-covid-had-no-effect-on-death-rates-in-america-total-deaths-normal-in-2020/ 

Johns Hopkins report that initially they pulled because they say it doesn’t say what it says. These data analyses suggest that in contrast to most people’s assumptions, the number of deaths by COVID-19 is not alarming. In fact, it has relatively no effect on deaths in the United States. 11/30/20

https://drive.google.com/file/d/1TYZuPcTk9mdHF6rio_hBpzBuBqtz3cdN/view 

https://web.archive.org/web/20201126163323/https://www.jhunewsletter.com/article/2020/11/a-closer-look-at-u-s-deaths-due-to-covid-19 

https://www.jhunewsletter.com/article/2020/11/a-closer-look-at-u-s-deaths-due-to-covid-19 

This presentation was led by Dr. Genevieve Briand, MS in Applied Economics Assistant Program Director. Genevieve went over where the data could be accessed and downloaded. Together with her, event attendees were invited to think critically about the data presented. 11/30/20

https://www.youtube.com/watch?v=3TKJN61aflI&feature=youtu.be 

To be sure, there are plenty of studies claiming that lockdowns saved lives but the high-profile ones are model-based extrapolations that presume the existence of a relationship that the facts do not seem to back up. 11/19/20

https://www.aier.org/article/the-virus-doesnt-care-about-your-policies 

AIER has long highlighted studies that show no gain in virus management from lockdowns.

https://www.aier.org/article/even-a-military-enforced-quarantine-cant-stop-the-virus-study-reveals 

Lockdowns are based on fraud: open letter to people who want freedom 12/4/20

https://blog.nomorefakenews.com/2020/12/03/lockdowns-are-based-on-fraud-open-letter-to-people-who-want-freedom/ 

Published Papers and Data on Lockdown Weak Efficacy – and Lockdown Huge Harms 12/7/20

https://thefatemperor.com/published-papers-and-data-on-lockdown-weak-efficacy-and-lockdown-huge-harms/ 

Scripture

Psalm 9:7-10 19-20 But the Lord sits enthroned forever; he has established his throne for justice, and he judges the world with righteousness; he judges the peoples with uprightness The Lord is a stronghold for the oppressed, a stronghold in times of trouble. And those who know your name put their trust in you, for you, O Lord, have not forsaken those who seek you.  19 Arise, O Lord! Let not man prevail; let the nations be judged before you! Put them in fear, O Lord! Let the nations know that they are but men! Selah

Asymptomatic Transmission

Covid 19: "Asymptomatic Transmission" 5/4/21

https://odysee.com/@drsambailey:c/Odysee-Exclusive---Covid-19-Asymptomatic-Transmission-Small-Video-:e 

I explore the core justification for the rising medical and technocratic tyranny our world is suffering with right now: the belief that healthy people are infecting others, and thus should be controlled at all times. Henna Marie  9/11/20

https://www.youtube.com/watch?v=_KIYtfDlXvE&feature=youtu.be 

When was the last time you were feeling perfectly healthy, went to the Dr. for a check-up, and they diagnosed you with a "virus" based on no symptoms at all? 3/29/21

https://nateserg808.wixsite.com/my-site/post/5-staple-items-for-autumn 

There is no asymptomatic spread of disease - Dr Andrew Kaufman 2/15/21

https://lbry.tv/@Alin:7/There-is-no-asymptomatic-spread-of-disease-Dr-Andrew-Kaufman:d 

COVID-19 patients with no symptoms likely to stay that way, Japan researchers say 1/12/21

https://www.japantimes.co.jp/news/2020/06/15/national/science-health/asymptomatic-covid-19-patients/ 

The virologist who unleashed the fraudulent PCR test for SARS CoV-2 last January, had this to say about SARS 1 in 2014,  "Asymptomatic people should not be tested with PCR." 12/11/20

https://www.sciencemag.org/news/2014/05/mers-virologists-view-saudi-arabia 

There were no positive tests amongst 1,174 close contacts of asymptomatic cases Can we stop the mass testing and quarantining of asymptomatic people now? Nearly 10 million people were included in this study done in Wuhan. Not a single transmission of "Covid19" from an asymptomatic person! 11/23/20

https://www.nature.com/articles/s41467-020-19802-w 

Asymptomatic transmission of COVID-19 didn’t occur at all, study of 10 million finds 12/28/20

https://www.lifesitenews.com/news/asymptomatic-transmission-of-covid-19-didnt-occur-at-all-study-of-10-million-finds

There’s more or less no such thing as an asymptomatic viral infection 10/19/20

https://medium.com/@vernunftundrichtigkeit/theres-more-or-less-no-such-thing-as-an-asymptomatic-viral-infection-8ce952e8b56

Why did one become ill with a childhood disease, like measles for example, while the other did not? The measles “bug” was in both of their bodies, in their collective bloodstream; so why didn’t both get the measles?

https://aruchiropractic.com/health-library/the-chiropractic-story-of-masha-and-dasha 

What is missing for the flawless proof that HIV, H5N1, SARS-CoV-2 etc. are viruses that enter the body from outside and cause illness – and what world-famous researchers like Luc Montagnier have to say

https://www.torstenengelbrecht.com/en/home/ 

CDC Admits There is No Proof COVID-19 is Airborne Virus and They Have Been Misleading the Public All Along

https://bluntforcetruth.com/news/cdc-admits-there-is-no-proof-covid-19-is-airborne-virus-and-they-have-been-misleading-the-public-all-along/

Asymptomatic scam

https://i.postimg.cc/WzzRrhC6/Asymptomatic.jpg 

90% of those who tested positive were without symptoms. Incredibly, 2% of the CHARM recruits still contracted the virus, even if all but one remained asymptomatic. “Our study showed that in a group of predominantly young male military recruits, approximately 2% became positive for SARS-CoV-2, as determined by qPCR assay, during a 2-week, strictly enforced quarantine.”

https://www.aier.org/article/even-a-military-enforced-quarantine-cant-stop-the-virus-study-reveals/ 

Dr. David B. Samadi breaks it down Asymptomatic cases NOT infectious

https://www.youtube.com/watch?v=g1gfjhCjHKc&feature=youtu.be 

Blood banks have adapted their collection practices to screen potential donors for COVID-19 symptoms or close contacts with known COVID-19. Tracking protocols have also been implemented to identify blood products from donors who develop COVID-19 disease postdonation. To date, no transfusion acquired COVID-19 has been reported, even when transfusions occurred with donations from pre symptomatic or asymptomatic donors. Moreover, SARS-CoV-2 has not been isolated from the blood of confirmed COVID-19 patients and neither have been other coronaviruses. 7/30/21

https://journals.lww.com/transplantjournal/fulltext/2021/07000/evidence_of_sars_cov_2_infection_in_cells,.7.aspx 

New Academic Study Confirms: Mass Testing of Asymptomatics Was a ‘Scam’

https://federalinquirer.com/new-academic-study-confirms-mass-testing-of-asymptomatics-was-a-scam/ 

Mike Donio

Confessions Of A Scientism Heretic w/ Mike Donio

https://www.youtube.com/watch?v=_R4w8kz7lbg

Scientist Speaks Out About the Hidden Sides of Biotech - Mike Donio. Biotech scientist Mike Donio was fired for his refusal to comply with injection mandates.  Join him and myself for a deep dive into why he's now speaking out against the industry, how trusting science is exactly what we shouldn't do, and what the scientific method really is.

https://www.youtube.com/watch?v=HCe5Rv_kMFQ

Scientific method

What is science?

Systematic knowledge of the physical or material world gained through observation and experimentation. Studying man made things and their effects is not science, those are simply studies,

What is the Scientific Method?

https://explorable.com/what-is-the-scientific-method 

https://biologydictionary.net/scientific-method/ 

“Science” (the method) attempts to determine the cause of an already observed effect (phenomenon). If you do not have an isolated (pure) independent variable (your presumed cause) which you can then vary and manipulate, then you are not conducting a “scientific experiment” - Dr Jordan Grant 

Independent Variable Definition and Examples

https://www.thoughtco.com/definition-of-independent-variable-605238 

PSI’s CEO, John O’Sullivan talks about his life and decade-long mission to expose scientific fraud in climate science and Big Pharma’s coronavirus scam. 12/28/20

https://principia-scientific.com/video-psis-john-osullivan-on-chipping-away-at-untruths/ 

The Credentials Fallacy: What It Is and How to Respond to It

https://effectiviology.com/credentials-fallacy/ 

Science vs Pseudoscience

https://i.postimg.cc/NfPJMzvZ/Science-vs-Pseudoscience.gif 

Professors Professor Igor Khmelinskii, Professor Leslie Woodcock and Professor Peter Stallinga

Three professors from Portugal tried to get their paper/study published by the Lancelot proving SARS-CoV-2 was never isolated and the PCR test therefore only gives false positives, but their paper was rejected. Professor Igor Khmelinskii, Professor Leslie Woodcock and Professor Peter Stallinga from the University of Algarve (Portugal) wrote a paper titled "Role of exosomes in false-positive covid-19 PCR tests". They argue that because the Sars-CoV-2 virus has never been isolated, the PCR tests are inaccurate as they may detect our own genetic material (exosomes), giving rise to a false-positive testing pandemic. The paper was rejected for publication by the Lancet and has been downloaded more than one hundred thousand times from ResearchGate in a week (the average number of downloads for most scientific papers is about ten per week).  Professor Leslie V. Woodcock - “It’s become an industry, and the PCR test is an international industry, and the medical profession is basically riddled with pseudoscience, experts’ or advice politicians. And we focus on this aspect in the letter to Nature and that was rejected in even faster time than the Lancelot.” 5/25/22

https://www.researchgate.net/publication/355972541_The_Lancet_Respiratory_Medicine_Role_of_exosomes_in_false-positive_covid-19_PCR_tests

https://researchreview.in/index.php/rr/article/view/78/119

https://www.humanley.com/blog/the-humanley-podcast-episode-46

PCR Test Kits

All Mike Stone PCR test papers

https://docs.google.com/document/u/1/d/e/2PACX-1vRZxpq29S9RDvLjw9KIXb_ogh9P1W0piNr8kLUa-zQEO3GPCJ5XMk5sOrHxRIqbD8BOjdB1ZTWXDdFt/pub

PCR AND REAL TIME RT-PCR UNDER CRITICAL REVIEW

https://criticalcheck.wordpress.com/2022/05/08/pcr-and-real-time-rt-pcr-under-critical-review/

Positive results do not rule out bacterial infection or co-infection with other viruses. The agent detected may not be the definite cause of the disease.

https://www.fda.gov/media/139832/download 

20 UNDENIABLE FACTS ABOUT PCR TESTS:

https://docs.google.com/document/d/e/2PACX-1vR4Fu7xXCriLubKIEpp1XDWQVpNpX6cd5auQ8rxTJORhie3VCiGM0lDVNdvIP_w8oBodxmJHypM-uYr/pub

The PCR Tests Are Ending - Dr. Tom Cowan 8/8/21

https://odysee.com/@Truth_will_set_You_Free:0/The-PCR-Tests-Are-Ending--Webinar-from-August-6th,-2021-fSeTfVghIAtc:1?r=4p5XrtE3iXACjJyk72bUG4pbrUJWn4Zu 

Austrian court overturns judgment: PCR test not suitable for diagnosis 4/6/21

https://www.info-direkt.eu/2021/03/31/oesterreichisches-gericht-kippt-urteil-pcr-test-nicht-zur-diagnostik-geeignet/ 

Jerneja Tomsic, Ph.D. She has been working with PCR technology for approximately 25 years. She discusses how the use of PCR technology in the tests that they are using to test for “Covid-19” makes the whole Covid narrative fall apart. She digs deep into PCR technology, what it is, and how it is being used. Please join us for this special episode." 12/11/21

https://rumble.com/vqlxfy-pcr-tests-cannot-prove-the-existence-of-a-virus.html 

COVID PCR TEST DEVELOPED WITHOUT ANY VIRUS 10/2/20

https://kevinpcorbett.com/coronahysteria/covid-pcr-test-developed-without-any-virus-rumour.html

The Classified Christian Drosten Files For it was Christian Drosten who developed the PCR Corona test in January 2020, which from then on served as the standard method for detecting the Coronavirus SARS-CoV-2 worldwide.

http://enformtk.u-aizu.ac.jp/howard/the_classified_drosten_files 

CT value in PCR 5/18/21

https://i.postimg.cc/0N0gWBmF/CT_Value_in_PCR.jpg 

Do not get tested…

https://www.bitchute.com/video/Fbt6rZkle4Xz/

Fauci acknowledged in the interview that at 35 cycles or higher, the chances of the test being accurate are “minuscule.”

https://principia-scientific.com/dr-fauci-admits-covid-test-picks-up-harmless-dead-virus/ 

https://principia-scientific.com/who-finally-admits-covid19-pcr-test-has-a-problem/ 

This article also states that most used a Ct of 40 while labs in Maine were running 45 cycles: CORONAVIRUS PCR tests and the prickly partnership between science and state 5/4/21

https://www.themainewire.com/2020/11/pcr-tests-prickly-partnership-science-state 

Here is a document from health care in Northern Ireland explaining it was run at 40 to 45 (!) cycles before vaccinations...5/4/21

https://i.postimg.cc/LsMN1Jfk/Cycle-threshold-for-PCR-tests.jpg 

Here is a smoking gun on the CDC lowering the PCR threshold for the injected... Clinical specimens for sequencing should have an RT-PCR Ct value ≤28. 5/4/21

https://www.cdc.gov/vaccines/covid-19/downloads/Information-for-laboratories-COVID-vaccine-breakthrough-case-investigation.pdf 

‘I still need to find one viable sample with Covid-19 to work with. We who conducted the lab test with these 1500 samples at the 7 universities are now suing the CDC for Covid-19 fraud. The CDC still has not sent us a viable, isolated and purified sample of Covid-19. If they can’t or won’t, then I say there is no Covid-19. It’s fictional.’ 4/15/21

https://greatreject.org/laboratories-cant-find-covid-19-in-positive-tests/ 

Confirmed: PCR Tests CANNOT Detect SARS-CoV-2, Cause Of COVID19 2/22/21

https://principia-scientific.com/confirmed-pcr-tests-cannot-detect-sars-cov-2-cause-of-covid19/ 

PCR pkg insert

https://rootofthetruth.com/rt-pcr-test-package-insert/ 

https://www.fda.gov/media/139832/download 

Covid test kit inventor Where previously terminally ill people were reported, now suddenly mild cases and people who are actually in perfect health are included in the reporting statistics.

http://www.jorgprobst.com/en/drosten-and-his-amazing-turnaround/ 

Australian government There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests 11/17/20

https://off-guardian.org/2020/09/05/australian-govts-own-website-admits-covid-tests-are-totally-unreliable 

This course of action is illegal in two respects. On the one hand, properties are attributed to the PCR test that it does not have. The results of these tests cannot therefore form a basis for any measure whatsoever. 11/25/20

https://viruswaarheid.nl/dagvaarding-pcr-test 

https://viruswaarheid.nl/wp-content/uploads/2020/11/Productie-5-Artikel-NRC-18-september-2020.pdf 

AAPS Do We Have a Coronavirus Pandemic, or a PCR Test Pandemic? 11/5/20

https://aapsonline.org/covid-19-do-we-have-a-coronavirus-pandemic-or-a-pcr-test-pandemic 

In case you thought the PCR test detects an actual virus…wrong 12/25/20

https://blog.nomorefakenews.com/2020/12/25/you-thought-the-pcr-test-detects-an-actual-virus-wrong/ 

The crisis will never end if we are waiting for zero positive tests. Everyone has probably had a cold caused by a coronavirus and will likely have a few viral fragments matching those of the cousin SARS-CoV-2 virus. Testing frequency in a country has no correlation with success in disease control. 11/5/20

https://aapsonline.org/covid-19-what-does-a-positive-pcr-test-mean/ 

YOU'LL NEVER GUESS WHAT'S IN THE TESTS Once Were the Living..the story of the 4th Industrial modified reset man. What's been put up your nose in nano dust "test swabs" and in your mRNA, 4th Industrial Revolution, Great Reset, how the nano dust tech works 2/5/21

https://www.bitchute.com/video/KO495u7J749A/ 

Fauci states COVID test has fatal flaw; confession from the “beloved” expert of experts 11/12/20

https://blog.nomorefakenews.com/2020/11/06/smoking-gun-fauci-states-covid-test-has-fatal-flaw/ 

The COVID-19 case counts, hospitalization numbers, and death counts are meaningless in their current fluid form. Their malleability primarily serves those who seek to distort reality. 11/5/20

https://jpands.org/vol25no3/held.pdf 

“We do not have a test for cure, and WE DO NOT HAVE A TEST FOR INFECTIOUSNESS,” said Omai Garner, a clinical microbiologist at the UCLA." 10/16/20

https://www.nytimes.com/2020/10/15/health/coronavirus-testing-negative.html 

PCR Tests Have Been Used to Create a 'Case-demic' 9/14/20

https://www.youtube.com/watch?v=dzaU6gzyAwo&feature=share 

A Positive Test Means You Have the Illness, or You Don’t – Dr Tom Cowan

https://drtomcowan.com/a-positive-test-means-you-have-the-illness-or-you-dont/

COVID19 PCR Tests are Scientifically Meaningless – Bulgarian Pathology Association

https://bpa-pathology.com/covid19-pcr-tests-are-scientifically-meaningless/ 

ANOTHER key architect of the COVID PCR test had no coronavirus; the whole fake COVID house is falling down. 10/13/20

https://blog.nomorefakenews.com/2020/10/13/yet-another-case-of-the-missing-virus-they-lied-and-locked-down-the-world/ 

We Are Being Lied To! Here Is How 10/3/20

https://www.youtube.com/watch?v=Ljxah4NrYKU 

Not a single PCR test can detect infection. It is impossible. 9/30/20

https://clubderklarenworte.de/wp-content/uploads/2020/09/transcript-german-pcr-interview-langemann-fuellmich-.pdf 

National Security Alert: COVID Tests Scientifically Fraudulent, Epidemic of False Positives

https://www.globalresearch.ca/national-security-alert-covid-tests-scientifically-fraudulent-epidemic-false-positives/5720271

“It’s [PCR] just a process that’s used to make a whole lot of something out of something. That’s what it is. It doesn’t tell you that you’re sick and it doesn’t tell you that the thing you ended up with really was going to hurt you or anything like that.”

http://activehealthcare.co.uk/index.php/literature/science/210-pcr-test-what-why-how 

Why the Inventor of The “Corona Test” Would Have Warned Us Not To Use It To Detect A Virus

https://madisonarealymesupportgroup.com/2020/05/07/was-the-covid-19-test-meant-to-detect-a-virus 

Microbiologist criticizes corona numbers: "Tested positive means not infected" PCR test can only represent a suspicion of an infection 10/1/20

https://www.haller-kreisblatt.de/region/22870086_Mikrobiologe-kritisiert-Corona-Zahlen-Positiv-getestet-heisst-nicht-infiziert.html

There is limited evidence available to assess the accuracy and clinical utility of available COVID-19 tests. 9/9/20

https://off-guardian.org/2020/09/05/australian-govts-own-website-admits-covid-tests-are-totally-unreliable 

Here’s the problem, we are testing people for any strain of a Coronavirus. Not specifically for COVID-19. There are no reliable tests for a specific COVID-19 virus.

https://www.marktaliano.net/an-anonymous-nurse-speaks-out-via-gareth-williams/ 

The PCR test is not validated

https://telegra.ph/Der-PCR-Test-ist-nicht-validiert-06-25 

The PCR test is one of several pillars that collapse if you take a closer look

https://telegra.ph/PCR-Ein-DNA-Test-wird-zum-Manipulationsinstrument-06-28 

Cant use diagnostic test as screening test Dr Sam Bailey.

https://lbry.tv/@drsambailey:c/why-are-covid-19-cases-soaring-in-nz-pcr:b 

The PCR Science fraud committed by Professor Christian Drosten

https://winteroakpress.files.wordpress.com/2020/07/the-scientific-fraud-by-prof.-christian-drosten-10.7.20.pages_.pdf

German Scientists Concede Covid PCR Tests Do Not Prove Infection: “The Only Reason For The Present Wave Of Panic Is What We Hear From The Media, At Least In The US.”  8/14/20

https://www.thetruthbarrier.com/2020/08/14/german-scientists-concede-that-covid-pcr-tests-do-not-prove-infection-the-only-reason-for-the-present-wave-of-panic-is-what-we-hear-from-the-media-at-least-in-the-us/

Open Letter: Refuting Politifact’s “fact check” on PCR Test Kits

https://off-guardian.org/2020/07/31/open-letter-refuting-politifacts-fact-check/ 

Are you infectious if you have a positive PCR test result for COVID-19?  

https://www.cebm.net/covid-19/infectious-positive-pcr-test-result-covid-19/

CDC: Coronavirus antibody tests could be wrong 50% of the time

https://www.mercurynews.com/2020/05/26/cdc-coronavirus-antibody-tests-could-be-wrong-50-of-the-time/

Viral cultures for COVID-19 infectivity assessment. Systematic review

https://www.medrxiv.org/content/10.1101/2020.08.04.20167932v1

Interpreting Diagnostic Tests for SARS-CoV-2 | Infectious Diseases

https://jamanetwork.com/journals/jama/fullarticle/2765837 

Coronavirus: The Truth about PCR Test Kit from the Inventor and Other Experts  

https://www.weblyf.com/2020/05/coronavirus-the-truth-about-pcr-test-kit-from-the-inventor-and-other-experts/

Tests for SARS-CoV-2 in South Korea Can’t Distinguish Virus from Viral Fragments

https://thevaccinereaction.org/2020/07/tests-for-sars-cov-2-in-south-korea-cant-distinguish-virus-from-viral-fragments/ 

External peer review of the RTPCR test to detect SARS-CoV-2 reveals 10 major scientific flaws at the molecular and methodological level: consequences for false positive results. 12/4/20

https://zenodo.org/record/4298004#.X8pF2GhKja8 

What is Covid-19, SARS-2. How is it Tested? How is It Measured? The Fear Campaign Has No Scientific Basis  

https://www.globalresearch.ca/what-is-covid-19-sars-2-how-is-it-tested-how-is-it-measured-the-fear-campaign-has-no-scientific-basis/5722566

If the PCR Test Is Unreliable - Why Are Health Officials Demanding the Public Be Tested?

https://www.thelastamericanvagabond.com/if-the-pcr-test-is-unreliable-why-are-health-officials-demanding-the-public-be-tested/

This test has not been FDA cleared or approved

https://ltd.aruplab.com/Tests/Pub/3002638

PCR positives: what do they mean? 10/9/20

https://www.cebm.net/covid-19/pcr-positives-what-do-they-mean/ 

Study suggesting the PCR test has an 80.33% asymptomatic false positive rate. Study removed

https://www.researchgate.net/publication/339770271_Potential_false-positive_rate_among_the_'asymptomatic_infected_individuals'_in_close_contacts_of_COVID-19_patients

Despite the RT-PCR test, COVID-19 diagnosis is highly unreliable

https://fort-russ.com/2020/05/covid-19-what-does-being-positive-really-mean-what-are-we-really-detecting/

COVID TEST DOESN’T TEST FOR COVID

https://jchristoff.com/covid-test-doesnt-test-for-covid/

UK Healthcare Worker Says COVID-19 Testing Kits Do Not Work

https://www.thebernician.net/uk-healthcare-worker-says-covid-19-testing-kits-do-not-work/

In the midst of viral panic, everybody ignores the problem of false positives, and they call for more tests

https://taiwanenglishnews.com/in-the-midst-of-viral-panic-everybody-ignores-the-problem-of-false-positives-and-they-call-for-more-tests/

COVID-19: Closer to the Truth: Tests and Immunity

https://www.globalresearch.ca/covid-19-closer-to-the-truth-tests-and-immunity/5720160

Two Vital experiments have not been done to determine accuracy of PCR test

https://blog.nomorefakenews.com/2020/04/10/covid-two-vital-experiments-that-have-never-been-done/

"Gold standard" can refer to the criteria by which scientific evidence is evaluated  

https://en.wikipedia.org/wiki/Gold_standard_(test) 

Is there a pandemic? The most confusing aspect of COVID-19 is reliance on a reverse transcriptase, polymerase chain reaction manufacturing technique (RT-PCR)

https://www.primarydoctor.org/is-there-a-pandemic

Cannot prove covid isolated, no isolates available 10/20/20

https://www.youtube.com/watch?v=AW8zjzPhS-s&feature=youtu.be 

PCR-testing proves *nothing*. Industry weaponized PCR by sanctioning unverified RNA-sequences to 'proof' the fake #HIV pandemic. Doing the same with #SARSCoV2

https://twitter.com/patricksavalle/status/1293827912689487872

Research summary and debunk regarding the existence of "SARS-CoV-2" and "COVID-19"

https://steemit.com/health/@johnblaid/research-summary-and-debunk-regarding-the-existence-of-sars-cov-2-and-covid-19 

As long as there is no clean isolation of the alleged virus and Koch's postulates are not adhered to, no test in this world can give a statement as to whether someone is infected! 8/22/20

https://telegra.ph/Der-PCR-Test-ist-nicht-validiert-06-25

The positive predictive value: garbage in - garbage out 8/22/20

https://multipolar-magazin.de/artikel/das-schweigen-der-viren

Stability Issues of RT-PCR Testing of SARS-CoV-2 for Hospitalized Patients Clinically Diagnosed with COVID-19 8/22/20

https://pubmed.ncbi.nlm.nih.gov/32219885/

CoronaVirus a reliable test is needed badly, we don’t have one.

http://healthinsightuk.org/2020/02/12/coronavirus-a-reliable-test-is-badly-needed-we-dont-have-one/

PCR test kits limitations

https://docs.google.com/document/d/1JPnQM5n1GaqA65ZHT4Kh9smC6aOaUbXVNiktpTQfKSE/edit?usp=drivesdk 

COVID19 Tests “Not Worth Anything – Two of us could do it Overnight in the Garage”

https://vaccineimpact.com/2020/roche-ceo-covid19-tests-not-worth-anything-two-of-us-could-do-it-overnight-in-the-garage/

WHO CV PCR Test Primer Sequence is Found in All Human DNA 8/21/20

https://pieceofmindful.com/2020/04/06/bombshell-who-coronavirus-pcr-test-primer-sequence-is-found-in-all-human-dna

The Tests: The Achilles Heel of the COVID-19 House of Cards

https://www.globalresearch.ca/the-tests-the-achilles-heel-of-the-covid-19-house-of-cards/5714325

Lies, Damned Lies and Health Statistics – the Deadly Danger of False Positives 9/19/20  

https://lockdownsceptics.org/lies-damned-lies-and-health-statistics-the-deadly-danger-of-false-positives/

PCR Tests: “Detaches Us From Reality” Says Doctor 11/10/20

https://79days.news/watch?id=5fa99be40ad7422090a1c74b 

Human chromosome 8 has this exact same 18-character sequence.

https://www.ncbi.nlm.nih.gov/nucleotide/NC_000008.11?report=genbank&log$=nuclalign&from=63648346&to=63648363

COVID diagnostic test: worst test ever devised? 9/10/20

https://blog.nomorefakenews.com/2020/09/10/covid-diagnostic-test-worst-test-ever-devised/

Austrian lawmaker tests cola for Covid and claims POSITIVE result returned shows testing is ‘worthless’ 12/12/20

https://www.rt.com/news/509377-austria-mp-test-cola-covid-positive/ 

No single test result is absolute and that is even more important with a test result based on P.C.R.” 10/16/20

https://blog.plan99.net/pseudo-epidemics-7603b2da839 

FDA letters acknowledge PCR tests are unproven, risky and inadequate 10/16/20

https://muchadoaboutcorona.ca/pcr-pandemic/

CDC Report: Officials Knew Coronavirus Test Was Flawed But Released It Anyway 11/6/20

https://www.npr.org/2020/11/06/929078678/cdc-report-officials-knew-coronavirus-test-was-flawed-but-released-it-anyway 

Wren Laboratories COVID-19 PCR Test

https://www.fda.gov/media/140773/download 

Should you take the CV test? Mikey Landings

https://www.youtube.com/watch?v=V1Im7jsW9_Y 

Watch This BEFORE You Take That Dang Test!!

https://www.bitchute.com/video/UouNTYb7AHw

The Infectious Myth - Simplifying RT-PCR

https://infectiousmyth.podbean.com/

History of PCR Testing at Dartmouth as reported by NY Times Dr Pam Popper 8/21/20

https://www.youtube.com/watch?v=NCUJ6yVWdis&feature=youtu.be 

Portuguese Court Rules PCR Tests As Unreliable & Unlawful To Quarantine People 11/20/20

https://www.thelibertybeacon.com/portuguese-court-rules-pcr-tests-as-unreliable-unlawful-to-quarantine-people/ 

President of Tanzania on the PCR Test

https://i.postimg.cc/Yqhq3WH5/test.jpg

FDA will not approve test kits

https://i.postimg.cc/bNbSWKpV/FDA-not-approved-PCR-test.jpg 

CDC test for past infections

https://i.postimg.cc/RFkNwFCN/CDC-test-for-past-infection.jpg

PCR test kits

https://i.postimg.cc/0rg2KHfm/PCR-Tests-kits.jpg

What is PCR test for?

https://i.postimg.cc/mDdJRBCg/PCR-test.jpg 

Testing a population with PCR tests

https://i.postimg.cc/43sS9m13/Testing-a-population-with-PCR-test.jpg 

What the failure rate of tests mean

https://i.postimg.cc/W4kCwQKY/PCR-Test-fail-rate.jpg 

Circular reasoning

https://i.postimg.cc/m2Kws0Hy/Circular-reasoning.jpg 

No proof virus is even causing the disease

https://i.postimg.cc/J7NHT038/Positive-test-results.jpg 

What does your test result mean?

https://i.postimg.cc/nLCQvv7r/Australian-Dept-of-Health-on-the-test-results.jpg

CDC positive test meaning

https://i.postimg.cc/QCWsXdRf/CDC-test-results-meaning.jpg

Not test for Covid

https://i.postimg.cc/g0m3MRKd/No-specific-test-for-covid-therefore-no-proof-of-covid.jpg

PCR test not approved by FDA

https://i.postimg.cc/Hkfx2Znz/RT-PCR-not-approved-by-FDA.jpg 

Thermo Fisher Scientific PCR test says not used for diagnostic 9/28/20

https://i.postimg.cc/B6KG1vj4/Thermo-PCR-Test.jpg 

PCR test cannot and must not detect infections

https://i.postimg.cc/DwDcRncb/PCR-test-cannot-and-must-not-detect-infections.jpg 

Misuse of PCR - Kerry Mullis

https://i.postimg.cc/ydFHx0Xh/Misuse-of-PCR.jpg 

Corona gene sequence in every human

https://i.postimg.cc/JhBRyR3V/Corona-gene-sequences-in-every-human-being.jpg 

PCR cycles determine positive result 11/12/20

https://i.postimg.cc/KzrL2knt/PCR-cycles.jpg 

Why misinterpretation of electron micrographs in SARS-CoV-2-infected tissue goes viral

https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)32079-1/fulltext 

Test Kits created before Covid

THE SEQUEL TO THE FALL OF THE CABAL - PART 18

https://www.bitchute.com/video/IjgzKGI0CcAp/ 

System and Method for Testing for COVID-19 Registered by Richard de Rothschild 2/25/21

https://patrickherbert.org/2021/02/17/system-and-method-for-testing-for-covid-19-registered-by-richard-de-rothschild/

Covid 19 testing patented in 2015

https://i.postimg.cc/v8fR9sFh/Covid-19-testing-patented-in-2015.jpg 

Covid tests patented in 2015 and 2017

https://worldtruth.tv/rothschilds-patented-covid-19-biometric-tests-in-2015-and-2017/

COVID-19 Diagnostic Test instruments and apparatus (902780) exports by country | 2018

https://wits.worldbank.org/trade/comtrade/en/country/ALL/year/2018/tradeflow/Exports/partner/WLD/nomen/h5/product/902780

2018 record of covid test kit sales

https://i.postimg.cc/prpXkhwb/2018-record-of-covid-test-kit-sales.jpg 

Covid test instruments by apparatus

https://i.postimg.cc/2SFmQ71L/Covid-test-instruments-by-apparatus.jpg 

Switzerland COVID-19 Test kits (300215) exports by country | 2017 | Data

https://wits.worldbank.org/trade/comtrade/en/country/CHE/year/2017/tradeflow/Exports/partner/ALL/nomen/h5/product/300215

Test kit instruments 2017

https://i.postimg.cc/pVhmD3R9/Test-kit-instruments-2017.jpg 

COVID-19 Test kits (300215) exports by country | 2016

https://wits.worldbank.org/trade/comtrade/en/country/ALL/year/2016/tradeflow/Exports/partner/WLD/nomen/h5/product/300215

WHO changed website after being exposed

https://i.postimg.cc/9fkW0F4L/WITS-Test-kits-changed-product-description.jpg 

Covid 19 test imports before covid started

https://i.postimg.cc/9FwQ79Py/CV-19-test-imports-before-covid-started.jpg 

Covid 19 test kits reclassification

https://i.postimg.cc/5tg4VS1W/Covid-19-test-kits-reclassification.jpg 

COVID-19 Diagnostic Test instruments and apparatus (902780) exports by country | 2018

https://web.archive.org/web/20200904061301if_/https://wits.worldbank.org/trade/comtrade/en/country/ALL/year/2018/tradeflow/Exports/partner/WLD/nomen/h5/product/902780

COVID-19 Test kits (300215) exports by country in 2018 | CFC

https://bbs.comefromchina.com/threads/1732658/

Trade interdependencies in Covid-19 goods

http://www.oecd.org/coronavirus/policy-responses/trade-interdependencies-in-covid-19-goods-79aaa1d6/

CDC Lies. Korona One Nine Test Kits Distributed Worldwide in 2018

https://www.youtube.com/watch?v=H7Ja3-sJCSk&feature=youtu.be 

Serious coverup and admission of guilt at play. https://mobile.twitter.com/shomburg/status/1302526439552618498?prefetchtimestamp=1599506588811

COVID-19 Test kits (300215) exports by country in 2017, COVID-19 Diagnostic Test instruments and apparatus Exports:

https://archive.is/8xgHH 

COVID-19 Diagnostic Test instruments and apparatus Imports:

http://archive.is/oJ7Ym 

2017, COVID-19 Test kits Exports:

http://archive.is/HoRla 

COVID-19 Diagnostic Test instruments and apparatus Imports:

https://archive.is/PTQiQ 

Covid 19 Test Kits Purchased And Received In 2017 And 2018 By Most World Governments

https://beforeitsnews.com/prophecy/2020/09/covid-19-test-kits-purchased-and-received-in-2017-and-2018-by-most-world-governments-wgon-video-2514110.html

Worldbank document

http://documents1.worldbank.org/curated/en/993371585947965984/pdf/World-COVID-19-Strategic-Preparedness-and-Response-Project.pdf 

Introduction of Sarscov3

https://oye.news/news/world-news/introducing-sars-cov-3-covid21 

How was this "novel" virus discussed in a paper in 2006? The “new” SARS-CoV2 was mentioned in Clinical Chemistry in 2006

https://academic.oup.com/clinchem/article/52/7/1446/5627058 

Moderna applied for an amended patent on the coronavirus vaccine on March 28, 2019, nine months before the coronavirus virus struck. 10/28/20

https://www.mentealternativa.com/moderna-patento-vacuna-9-meses-antes-de-que-apareciera-el-covid-19-previendo-un-rebrote-del-virus-sars/

Patents submitted as far back as 1999

https://odysee.com/@Corona-Ausschuss:3/Sitzung-60-Die-Zeit-ist-kein-flacher-Kreis-5-Martin:f 

ROTHSCHILDS PATENTED COVID-19 BIOMETRIC TESTS IN 2015. AND 2017.

https://rightsfreedoms.wordpress.com/2021/04/18/atomic-bombshell-rothschilds-patented-covid-19-biometric-tests-in-2015-and-2017/ 

SarsCov2 and SarsCov3

There are some coronaviruses that share this sequence, among them SARS-CoV-1/2/3

https://www.ebi.ac.uk/ena/browser/view/AY864806 

They only used 37 base pairs from actual sample tissue and filled in the rest (around 30,000 base pairs) with computer generated sequences, i.e. they made it up!

https://wwwnc.cdc.gov/eid/article/26/6/20-0516_article 

They are all artificially created genomes. "SARS-CoV-2" back in 2008 is just 303bp and a part of "SARS-CoV" which is the whole artificially created genome. 12/3/20

http://europepmc.org/article/PMC/PMC2395109

Why was "SARS-CoV-2" discussed back in 2008 12/3/20

https://www.thailandmedical.news/news/covid-19-questions-why-was-sars-cov-2-and-also-sars-cov-3-viruses-mentioned-in-published-study-in-2008-that-was-catalogued-by-u-s--nih

"SARS-CoV-2" and SarsCov3 discussed in 2008 12/3/20

https://www.thailandmedical.news/news/breaking-covid-19-news-ibm-study-shows-co-infections-with-various-sars-cov-2-lineages-becoming-common-heteroplasmy-more-prevalent-that-thought

SARSCOV2 strains emerging 12/3/20

https://www.thailandmedical.news/news/covid-19-latest-more-antibody-resistant-sars-cov-2-mutated-strains-emerging-and-increasing-in-circulation 

Appearances Can Be Deceiving - Viral-like Inclusions in COVID-19 Negative Renal Biopsies by Electron Microscopy

https://kidney360.asnjournals.org/content/1/8/824 

SARS-CoV-2 organizing pneumonia: 'Has there been a widespread failure to identify and treat this prevalent condition in COVID-19?' 8/2/21

https://pubmed.ncbi.nlm.nih.gov/32963028/ 

Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome

https://www.ncbi.nlm.nih.gov/nuccore/1798174254 

The association between 2019-nCoV and the disease has not been verified by animal experiments to fulfill the Koch’s postulates to establish a causative relationship between a microorganism and a disease. We do not yet know the transmission routine of this virus among hosts.

https://viroliegy.com/2021/09/24/lack-of-sars-cov-2-animal-models/ 

Ethylene Oxide

Carcinogenic Ethylene Oxide used in sterilizing test kit swabs

https://docs.google.com/document/d/e/2PACX-1vQB5N9CBbKc8idP0LiU7QoRS1GeVJoIJZH3gkJIvYTdgvJPVcmbhrbqQ7lht-uHbLQYjHdOPNnBL4zc/pub

Ethylene Oxide: The Coming Storm?

https://environmentallawmonitor.com/epa/ethylene-oxide-the-coming-storm/

Ethylene Oxide Inside Children’s Covid19 Rapid Antigen Lateral Flow Test Kits

https://wirralinittogether.blog/2021/03/25/ethylene-oxide-inside-childrens-covid19-rapid-antigen-lateral-flow-test-kits/ 

Cancer-causing ethylene oxide in children’s Covid19 Rapid Flow test kits. A quick response is in from Public Health England (North West)

https://wirralinittogether.blog/2021/03/26/cancer-causing-ethylene-oxide-in-childrens-covid19-rapid-flow-test-kits-a-quick-response-is-in-from-public-health-england-north-west/ 

Ethylene Oxide in test kits

https://i.postimg.cc/SNpCVPZT/ETHYLENE-OXIDE.jpg 

Nucleic Acid Test

All kinds of drinks cause positive test

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8372450 

Landmark legal ruling finds that Covid tests are not fit for purpose. 1/4/21

https://www.nexusnewsfeed.com/article/geopolitics/msm-deathly-silent-as-pcr-test-legally-ruled-useless-to-test-for-covid 

PCR AND REAL TIME RT-PCR UNDER CRITICAL REVIEW

https://criticalcheck.wordpress.com/2022/05/08/pcr-and-real-time-rt-pcr-under-critical-review/

They made up the nucleic acid sequence from human DNA via GenBank.

https://www.fda.gov/media/134922/download

Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR

https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045 

New scientific paper on the PCR fraud, 22 authors. In light of our re-examination of the test protocol to identify SARS-CoV-2 described in the Corman-Drosten paper we have identified concerning errors and inherent fallacies which render SARS-CoV-2 PCR test useless.11/30/20

https://cormandrostenreview.com/report/

PCR test says absolutely nothing about the significance of the RNA being searched for. Therefore one thing is clear from the beginning. With a PCR test you can not detect a virus or any kind of infection.  12/4/20

https://telegra.ph/PCR---A-critical-examination-11-29 

C. Drosten et al published their paper describing the de facto industry standard protocol for detection of # SARSCoV2 by PCR. Now an intl. team of top experts asks for RETRACTION. The protocol is fatally flawed: it can NOT DETECT the virus. 12/4/20

https://threadreaderapp.com/thread/1333171959832711168.html 

https://twitter.com/patricksavalle/status/1333171977583009793 

The Case against Rapid Mass Testing for "Coronavirus:"  2/24/21

https://docs.google.com/document/d/e/2PACX-1vRngCUUfZM6jouC6bdvDxOCbzVYRrH6FPfJpcIMCe8ooR5Llkq5dmsfCTd1OMM5HGfSucGjBJdgnrOE/pub

Cambridge Documents: Of All Positive COVID Tests Of 9,000+ Students, 100% Were FALSE POSITIVES 12/12/20

https://www.dcclothesline.com/2020/12/10/bombshell-cambridge-documents-of-all-positive-covid-tests-of-9000-students-100-were-false-positives/ 

WHO, in a recent document, recognized that molecular RT-PCR tests, normally using too many PCR cycles, produce too many false positives 1/7/21

https://www.who.int/news/item/14-12-2020-who-information-notice-for-ivd-users 

The real pandemic is an outbreak of PCR testing 12/21/20

https://blog.nomorefakenews.com/2020/12/17/the-real-pandemic-is-an-outbreak-of-pcr-testing/ 

CDC Report: Officials Knew Coronavirus Test Was Flawed But Released It Anyway

https://www.npr.org/2020/11/06/929078678/cdc-report-officials-knew-coronavirus-test-was-flawed-but-released-it-anyway 

WHO has received user feedback on an elevated risk for false SARS-CoV-2 results when testing specimens using RT-PCR reagents on open systems. 12/21/20

https://www.who.int/news/item/14-12-2020-who-information-notice-for-ivd-users 

How the PCR scam works. PCR cannot be used as a diagnostic because of the variables. If something, by its design, cannot be consistent it can’t describe anything. The fact that a cycle threshold is part of the process nullifies its diagnostic capabilities. The only way around that is setting a ceiling, introducing a constant. if something is not binary it can’t be used as a test.

https://i.postimg.cc/ZYDD3tSp/How-the-PCR-scam-works.jpg 

Public Health agent Freudian slips - admits PCR tests amplified to 40 in Ontario 11/13/20

https://www.youtube.com/watch?v=7znL-MgBrbo&feature=youtu.be 

Dr Cowan PCR corona test is impossible

https://www.bitchute.com/video/Hx9PmAbdZsud/ 

The COVID-19 RT-PCR Test: How to Mislead All Humanity. Using a “Test” To Lock Down Society 12/4/20

https://www.globalresearch.ca/covid-19-rt-pcr-how-to-mislead-all-humanity-using-a-test-to-lock-down-society/5728483 

Fauci warns that widely used COVID tests may pick up 'dead' virus 11/10/20

https://justthenews.com/politics-policy/coronavirus/newly-surfaced-video-july-fauci-tests-dead-virus 

The amount of material collected by nasopharyngeal swabs is imprecise. 11/3/20

https://www.journalofinfection.com/article/S0163-4453(20)30675-7/fulltext 

The proof that RT-PCR test detects presence of viral genetic material in a sample but is not able to distinguish whether infectious virus is present. 11/13/20

https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/926410/Understanding_Cycle_Threshold__Ct__in_SARS-CoV-2_RT-PCR_.pdf

RT-PCR cannot detect infectious virus 11/13/20

https://i.postimg.cc/ZRsySV43/RT-PCR-CANNOT-detect-infectious-virus.jpg 

Not all of these tests are approved for screening individuals with no symptoms and some may not be appropriate for this purpose. 11/12/20

https://wach.com/news/local/state-health-officials-warn-against-rapid-test-for-holida-gatherings 

The estimation of diagnostic accuracy of tests for COVID-19: A scoping review 11/3/20

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7457918 

RT-PCR: Does the CT Value of Above 24 Mean You Are Not Infectious? 11/3/20

https://fit.thequint.com/coronavirus/covid-19-what-is-ct-value-and-how-is-it-related-to-infectivity 

Asymptomatic people should not be tested with PCR. Drosten 10/5/20

https://www.sciencemag.org/news/2014/05/mers-virologists-view-saudi-arabia

Nucleic acid testing-benefits and constraints

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3943139/

Many nucleic acid tests (NATs) include a step that amplifies the genetic material

https://en.wikipedia.org/wiki/Nucleic_acid_test

ADA - companies are not allowed to require employees to take the test Dr Pam Popper

https://www.youtube.com/watch?v=10Se0hRkV9Q

What does the test actually measure? 8/22/20

https://www.wodarg.com/2020/04/01/was-misst-der-test-eigentlich/

A spate of mysterious second-time infections is calling into question the accuracy of COVID-19 diagnostic tools 8/22/20

https://www.npr.org/sections/goatsandsoda/2020/03/27/822407626/mystery-in-wuhan-recovered-coronavirus-patients-test-negative-then-positive

On PCR, LSD, and Science as a Wild Ride 10/12/20

https://boomcalifornia.com/2015/11/12/on-pcr-lsd-and-science-as-a-wild-ride/

COVID-19: What Is CT Value and How Is It Related To Infectivity? 10/16/20

https://fit.thequint.com/amp/story/coronavirus/covid-19-what-is-ct-value-and-how-is-it-related-to-infectivity

Ct values from SARS-CoV-2 diagnostic PCR assays should not be used as direct estimates of viral load 10/26/20

https://www.journalofinfection.com/article/S0163-4453(20)30675-7/fulltext 

The Live-Dead qRT-PCR problem, the testing industrial complex and its impact on society.

https://twitter.com/Kevin_McKernan/status/1320538413108518912 

Plenty of isolates of what they are calling sar-cov-2. The problem being that they only make up just 11% of the total genome they created using a machine. 10/28/20

https://www.beiresources.org/BEIHighlights1.aspx 

What the whole genome sequencing looks like after they create the fictional virus through RNA genomics aka high level pseudoscience using a sequence machine called the NextSeq 550. Here is 522 different types they have created for different reasons including creating a vaccine.

https://www.ncbi.nlm.nih.gov/structure/?term=sars-cov-2

Here a taxonomy breakdown of the make up of sars-cov-2 which shows its only just 11% of the total of the whole genome sequence they made up using a machine and chemicals.

https://trace.ncbi.nlm.nih.gov/Traces/sra/?run=SRR12897641

Genome Data from Africa Reveal Millions of New Variants 11/10/20

https://directorsblog.nih.gov/2020/11/10/genome-data-from-africa-reveals-millions-of-new-variants/amp/ 

Current studies estimating test performance characteristics have imperfect study design and statistical methods for the estimation of test performance characteristics of SARS-CoV-2 tests.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7457918/ 

If Pretest Probability is low, PCR False-positives are HIGH. **Predictive values ARE AFFECTED BY PRETEST PROBABILITY. 11/13/20

https://www.cdc.gov/coronavirus/2019-ncov/lab/resources/antigen-tests-guidelines.html 

Chinese researchers didn't have the RNA. What they had was the manufactured and amplified DNA from the PCR test. And that's why their genome includes t instead of u. 11/13/20

https://www.ncbi.nlm.nih.gov/nuccore/MN908947

PCR and Serological studies

https://docs.google.com/spreadsheets/d/1zC3kW1sMu0sjnT_vP1sh4zL0tF6fIHbA6fcG5RQdqSc/edit 

Australian Govt says test dont detect covid 11/18/20

https://i.postimg.cc/pTjpdWqZ/Australian-Govt-says-tests-dont-detect-covid.jpg 

False negatives and positives: How accurate are PCR tests for Covid-19? 11/18/20

https://www.thenationalnews.com/uae/science/false-negatives-and-positives-how-accurate-are-pcr-tests-for-covid-19-1.1113187 

Portuguese Court Rules PCR Tests As Unreliable & Unlawful To Quarantine People 11/23/20

https://greatgameindia.com/portuguese-court-pcr-tests-unreliable/ 

THE SEQUENCES OF THE SO-CALLED SARS-COV-2 ARE FOUND BOTH IN HUMANS AND IN NUMEROUS MICROBES!

https://blast.ncbi.nlm.nih.gov/Blast.cgi 

COVID Diagnosis with PCR | Misinterpreting results | Cycle threshold 11/25/20

https://www.youtube.com/watch?v=S_1Z8cSXI-Q&feature=youtu.be 

PCR test package insert

https://rootofthetruth.com/covid-19/ 

Ten Fatal Errors: Scientists Attack Paper That Established PCR Driven Lockdown 12/6/20

https://uncoverdc.com/2020/12/03/ten-fatal-errors-scientists-attack-paper-that-established-global-pcr-driven-lockdown/ 

On NPO Radio 1, Marion Koopmans said “You only test whether someone carries a piece of RNA that can be months old”. Jaap van Dissel also stated such cases against Wybren van Haga during a technical hearing, but now Koopmans is also clear.  “All the corona policy is based on the PCR tests, which now appear to be invalid,” says Drs Mario Ortiz Buijsse (biochemist) who was present in the studio 12/6/20

https://www.youtube.com/watch?v=flsF7trvq2c&feature=youtu.be 

Kevin McKernan, PhD, on the MULTIPLE issues with the PCR test 12/7/20

https://docs.google.com/document/d/e/2PACX-1vRxy3odNWGgN9wf7X-4GYyv05bZgtWM4sJVq7a6hAZ8X3ktwmClVHdjqwBzwC4usNk6BJMzN0kU5uPO/pub 

Flawed paper behind Covid-19 testing faces being retracted, after scientists expose its ten fatal problems 12/9/20

https://www.rt.com/op-ed/509163-covid-19-test-flawed-withdrawn/ 

Drosten changed on pcr test use since mers in 2014 12/11/20

https://i.postimg.cc/QtcNwNRy/Drosten-on-PCR-test-in-2014-for-MERS.jpg 

It’s impossible to culture and detect viral culture greater than 35 cycles

https://i.postimg.cc/y80fDMCz/PCR-cycles-greater-than-35.jpg 

Understanding cycle threshold (Ct) in SARS-CoV-2 RT-PCR 12/21/20

https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/926410/Understanding_Cycle_Threshold__Ct__in_SARS-CoV-2_RT-PCR_.pdf 

Coronavirus Scandal Breaking in Merkel’s Germany. False Positives and the Drosten PCR Test

https://www.globalresearch.ca/coronavirus-scandal-breaking-merkel-germany/5731891 

CDC’s Diagnostic Multiplex Assay for Flu and COVID-19 at Public Health Laboratories and Supplies 12/28/20

https://www.cdc.gov/coronavirus/2019-ncov/lab/multiplex.html 

Positive tests as they are counted today do not indicate a “case” of anything. They indicate that viral RNA was found in a nasal swab. 1/5/21

https://www.zerohedge.com/covid-19/fda-admits-pcr-tests-give-false-results-prepares-ground-biden-virus-rescue-miracle

Faith in Quick Test Leads to Epidemic That Wasn’t

https://eumeswill.wordpress.com/2020/08/11/faith-in-quick-test-leads-to-epidemic-that-wasnt/ 

Overdiagnosis

Overdiagnosis is one of the most harmful and costly problems in modern healthcare. It often triggers a cascade of overtreatment, although the two are not synonymous. 12/22/20

https://ebm.bmj.com/content/23/1/1 

Scripture

Ephesians 5:6 "Let no one deceive you with empty words, for because of these things the wrath of God comes upon the sons of disobedience."

Case definition

By a case definition we mean the standard criteria for categorizing an individual as a case.

https://sphweb.bumc.bu.edu/otlt/MPH-Modules/PH/Outbreak/Outbreak4.html 

Signs and symptoms to determine if a patient presenting in primary care or hospital outpatient settings has COVID‐19 disease

https://www.cochranelibrary.com/cdsr/doi/10.1002/14651858.CD013665/full 

WHO COVID-19 Case definition

https://www.who.int/publications/i/item/WHO-2019-nCoV-Surveillance_Case_Definition-2020.2 

Clinical Infectious Diseases - Ct greater than 24 low infectivity

https://academic.oup.com/cid/article/71/10/2663/5842165 

98 supposed symptoms of covid

https://dig.abclocal.go.com/wls/documents/2020/072720-wls-covid-symptom-study-doc.pdf 

Anaphylaxis

Charles Richet Nobel Lecture The first injection, instead of protecting the organism, renders it more fragile and more susceptible. This is anaphylaxis. "We are so constituted that we can never receive other proteins into the blood than those that have been modified by digestive juices. Every time alien protein penetrates by effraction, the organism suffers and becomes resistant. This resistance lies in increased sensitivity, a sort of revolt against the second parenteral injection which would be fatal. At the first injection, the organism was taken by surprise and did not resist. At the second injection, the organism mans its defenses and answers by the anaphylactic shock. Seen in these terms, anaphylaxis is an universal defense mechanism against the penetration of heterogeneous substances in the blood, whence they can not be eliminated."

https://www.nobelprize.org/prizes/medicine/1913/richet/lecture/ 

The clinical manifestations of anaphylaxis can vary in onset, appearance, and course. Common symptoms usually include weakness, dizziness, flushing, angioedema, urticaria of the skin, congestion, and sneezing. More severe symptoms include upper respiratory tract obstruction, hypotension, vascular collapse associated with angioedema and urticaria, gastrointestinal distress, cardiovascular arrhythmias, and/or arrest.

https://jamanetwork.com/journals/jamainternalmedicine/fullarticle/646961 

Anaphylactic shock following the diagnosis of coronavirus disease 2019

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7395240/ 

Scripture

Romans 12:1-2 Therefore, I urge you, brothers and sisters, in view of God’s mercy, to offer your bodies as a living sacrifice, holy and pleasing to God—this is your true and proper worship. 2 Do not conform to the pattern of this world, but be transformed by the renewing of your mind. Then you will be able to test and approve what God’s will is—his good, pleasing and perfect will.

ANOSMIA/Loss of taste and smell

HOW MANY PEOPLE SUFFER FROM ANOSMIA?

https://www.anosmiafoundation.com/suffer.shtml 

Anosmia—A Clinical Review

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5863566/ 

CAN THE FLU PERMANENTLY DAMAGE YOUR SENSE OF SMELL?

https://www.raleighcapitolent.com/blog/lost-sense-of-smell?entryid=109&tabid=89 

Loss of smell

https://www.mayoclinic.org/symptoms/loss-of-smell/basics/causes/sym-20050804 

"ALMOST TWO OUT OF THREE AMERICANS HAVE SUFFERED A TEMPORARY LOSS OF SMELL;

https://docs.google.com/document/d/e/2PACX-1vSYtYBjJGY1eq0Vs_XHbnwEAy3guKLUQvJg21Qey9_lQcTlGsVVUnWmJC6ONgJ_cKfwZ7DO3IwNurwa/pub 

Sense of Smell Can Be Victim of Bout With Flu

https://www.latimes.com/archives/la-xpm-1988-02-21-mn-44059-story.html 

Homeostasis

Homeostasis: The Underappreciated and Far Too Often Ignored Central Organizing Principle of Physiology

https://www.frontiersin.org/articles/10.3389/fphys.2020.00200/full 

Cold, Flu, Fever

The flu never went away because it was never here to begin with

https://steemit.com/science/@johnblaid/the-flu-never-went-away-because-it-was-never-here-to-begin-with 

Does Influenza even spread between humans? Dr Sam looks into the scientific evidence behind Influenza transmission. 4/20/21

https://www.youtube.com/watch?v=wzGxKTzuDv0 

Cold & flu are not contagious

https://i.postimg.cc/c4fGxX4N/Cold-flu-not-contagious.jpg 

Another cause of your cold & flu like symptoms

https://docs.google.com/document/d/e/2PACX-1vT3a58yYIdhwVVqTqU_LdP0f_PHNG0pcO740Z3xHyr1Y7AaehN8NQmRvprsii2wmXCSV7qUx4syaODc/pub 

But what if I told you that there isn't even such a thing as "flu virus," in the sense of a monolithic, disease vector existing outside of us, conceived as it is as the relationship of predator to prey?

https://www.sott.net/article/339597-Why-The-Only-Thing-Influenza-May-Kill-is-Germ-Theory-Corona-Virus-Related 

Transmission of Influenza: Implications for Control in Health Care Settings.  Although droplet transmission is thought to be the primary mode of influenza transmission, limited evidence is available to support the relative clinical importance of contact, droplet, and droplet nuclei (airborne) transmission of influenza.

https://academic.oup.com/cid/article/37/8/1094/2013282 

"Any doubt about the communicability of influenza from those ill with the disease is dispelled by studies in crowded, confined, or isolated populations"

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2279112/ 

History of influenza 1/31/21

https://www.youtube.com/watch?v=eDb6CPN3Ao0&feature=youtu.be 

Health conditions and environments that can affect our taste sensation

https://www.doctorshealthpress.com/general-health-articles/loss-of-taste-impaired-taste-causes-symptoms-and-treatments/ 

 "Experiments on the spread of colds".start at the bottom of page 339 through 340

https://www.cambridge.org/core/services/aop-cambridge-core/content/view/D670B9E2A0978FDA6150365761B27D1B/S0022172400045228a.pdf/experiments-on-the-spread-of-colds-ii-studies-in-volunteers-with-coxsackievirus-a21.pdf

FURTHER STUDIES ON THE NATURAL TRANSMISSION OF THE COMMON COLD

https://sci-hub.st/10.1016/s0140-6736(52)91502-x 

https://sci-hub.do/10.3181/00379727-28-5152 

Can You Catch the Flu? Spanish Flu and the Infectious Myth

https://truthiverse.com/25 

In 2003, Bridges et al reviewed influenza transmission and found "no human experimental studies published in the English-language literature delineating person-to-person transmission of influenza. 12/12/20

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2279112/ 

The troubling similarities between the flu and COVID-19 Influenza and COVID-19 have essentially the same symptoms, so testing is the only way to find out which virus is causing the infection. 12/28/20

https://health.clevelandclinic.org/why-you-definitely-need-to-get-a-flu-shot-this-year/ 

The common cold

https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(03)12162-9/fulltext 

Research indicates that most of what is believed about the purportedly deadly properties of viruses like influenza is, in fact, not evidence-based but myth

https://www.greenmedinfo.com/blog/why-only-thing-influenza-may-kill-germ-theory 

Influenza is not contagious (in the way we are told)

https://www.discerningreality.com/post/influenza-is-not-contagious-in-the-way-we-are-told 

Why Flu Virus Doesn't Exist (The Way We Were Told)

https://www.greenmedinfo.com/blog/why-only-thing-influenza-may-kill-germ-theory 

Why Getting Cold This Winter Is A Good Idea 11/24/20

https://www.westonaprice.org/podcast/why-getting-cold-this-winter-is-a-good-idea/ 

Dr Bieler what causes cold and flu season

https://i.postimg.cc/sfhJk9kr/Dr-Bieler-cold-and-flu-season.jpg 

Dr Bieler what exactly is the common cold

https://i.postimg.cc/vmKWjcXT/What-exactly-is-common-cold.jpg 

How to Heal Colds and Flus Naturally Amandha Vollmer 10/28/20

https://vimeo.com/468676156 

Colds are as misunderstood as they are common

http://rawschool.com/common-cold 

Influenza is detoxing = humanity has been poisoned

https://www.discerningreality.com/post/influenza-is-detoxing-humanity-has-been-poisoned 

If influenza is detoxing, what exactly is a 'virus' then?

https://www.discerningreality.com/post/if-influenza-is-detoxing-what-exactly-is-a-virus-then-in-plain-english 

Covid numbers vs Flu numbers

https://i.postimg.cc/L4xyMJJ1/Covid-vs-FLu.jpg 

Why Modern Medicine Cannot Cure the Common Cold - What Really Makes You Ill

https://whatreallymakesyouill.com/why-modern-medicine-cannot-cure-the-common-cold/

68 

Flu Facts! A Look The Odd, Scary and Interesting History Of The Virus! https://pcmworldnews.com/news/2017/08/flu-facts-a-look-the-odd-scary-and-interesting-history-of-the-virus/

Dr. TC Fry on cold and flu

https://i.postimg.cc/jdjqzSZZ/Dr-TC-Fry-on-Colds-and-Flu.jpg 

Dr Shelton instructions on how to treat the flu

https://i.postimg.cc/R0Y28pV2/Dr-Shelton-instructions-on-how-to-treat-flu.jpg 

On the epidemiology of influenza Obviously, another explanation is that sick-to-well transmission is not the usual mode of contagion.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2279112/

Cold and Flu Symptoms are good for you

https://maxliving.com/healthy-articles/cold-and-flu-symptoms-are-good-for-you

Real cause of cold & flu symptoms

https://i.postimg.cc/C1hVf49n/cold-and-flu-symptoms.jpg

Real cause of cold and flu symptoms

https://www.abc.net.au/news/science/2017-07-07/real-cause-of-cold-and-flu-symptoms/86567

Are Viruses Making Us Sick or Are We Making Ourselves Sick? 9/25/20

https://jchristoff.com/are-viruses-making-us-sick-or-are-we-making-ourselves-sick/

Cold Germs

https://i.postimg.cc/HkFJ5t8v/question.jpg

CoronaVirus is the common cold as defined by medical dictionaries

https://i.postimg.cc/k4JGKTmp/cold.jpg

Fever The Laws of Cure

https://chestofbooks.com/health/natural-cure/Henry-Lindlahr/Nature-Cure/Chapter-VI-The-Laws-of-Cure.html

Flu and pneumonia infections increase risk of having a heart attack and stroke

https://www.ersjournals.com/press/2203/respiratory-infections-trigger-stoke-mycocardial-infarction

Common Cold numbers

https://postimg.cc/JH1zK3nj

Influenza evidence against contagion

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1292615/pdf/jrsocmed00137-0072.pdf

What is the Flu

https://i.postimg.cc/W1zqRxyp/Flu.jpg 

Flu not caused by germs

https://i.postimg.cc/NfhXWgqg/Flu-cause.jpg 

Different strains of colds

https://i.postimg.cc/tTNXjqMr/commoncold.jpg 

Colds and flu causes

http://whale.to/a/colds_and_flu.html

The diseases, conditions, behavioural diagnosis

http://whale.to/v/diseases.html 

Are US flu death figures more PR than science?

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1309667/

Flu deaths are way overcounted

https://i.postimg.cc/KzSP8r1W/Flu-deaths-over-counted.jpg 

Don't Believe Everything You Read About Flu Deaths  

https://www.huffingtonpost.ca/lawrence-solomon/death-by-influenza_b_4661442.html

Flu Facts! A Look The Odd, Scary And Interesting History Of The Virus!

http://pcmlifestyle.com/2017/08/29/flu-facts-look-odd-scary-interesting-history-virus/

Common Cold symptoms Mayo Clinic

https://www.mayoclinic.org/diseases-conditions/common-cold/symptoms-causes/syc-20351605 

Scientific proof colds and flu are not contagious

https://www.youtube.com/watch?v=HtJh7y7V9MI&feature=youtu.be

Very quick presentation to help you work through how to properly manage a cold or a flu

https://www.bitchute.com/video/9ah6oGYPeySw/ 

Flu Facts! A Look The Odd, Scary and Interesting History Of The Virus!

https://pcmworldnews.com/news/2017/08/flu-facts-a-look-the-odd-scary-and-interesting-history-of-the-virus/

NHS references Covid 19 as the common cold

https://i.postimg.cc/rFLWTMK9/NHS-renamed-Covid-to-Common-Cold.jpg 

Symptoms of Coronavirus A recent Harvard study finds that vulnerables to the "virus" are generated by long-term air pollution.  8/20/20

https://projects.iq.harvard.edu/covid-pm 

Are your cold symptoms from Hydrogen Cyanide very similar symptoms to CV

https://i.postimg.cc/KjpWzFsJ/Hydrogen-Cyanide-very-similar-symptons-to-CV.jpg

Cleansing symptoms

https://i.postimg.cc/J4YhPn8b/Cleansing-symptoms.jpg 

COVID-19 and the Flu Are Similar symptoms

https://www.prevention.com/health/a33980996/coronavirus-vs-flu/

FLU AND THE FLU VACCINE RACKET

http://whale.to/vaccines/flu.html

Cold and flu vs covid

https://i.postimg.cc/FzrSsrZ8/picture.jpg 

An outbreak of common colds at an Antarctic base after seventeen weeks of complete isolation. Six of 12 men wintering at an isolated Antarctic base sequentially developed symptoms and signs of a common cold after 17 weeks of complete isolation. Examination of specimens taken from the men in relation to the outbreak has not revealed a causative agent.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2130424/ 

Scripture

1 Corinthians 16-17 Don’t you know that you yourselves are God’s temple and that God’s Spirit dwells in your midst? If anyone destroys God’s temple, God will destroy that person; for God’s temple is sacred, and you together are that temple.

Mark 2:17 When Jesus heard it, he saith unto them, They that are whole have no need of the physician, but they that are sick: I came not to call the righteous, but sinners to repentance." ... I have come to call not those who think they are righteous, but those who know they are sinners.

Psalm 139:13-16 For You created my innermost parts; You wove me in my mother’s womb. I will give thanks to You, because I am awesomely and wonderfully made; Wonderful are Your works, And my soul knows it very well. My frame was not hidden from You When I was made in secret, And skillfully formed in the depths of the earth; Your eyes have seen my formless substance; And in Your book were written All the days that were ordained for me, When as yet there was not one of them.

Jeremiah 1:5 “Before I formed you in the womb I knew you, And before you were born I consecrated you; I have appointed you as a prophet to the nations.”

Contagion: perspectives from pre-modern societies,

The purpose of this book is to question the importance of the notions of contagion in pre-modern societies. It could perhaps be summarized by a sentence in Vivian Nutton's lucid paper, "On almost all ancient schemata, contagion, whether in the strict sense of a disease transmitted by touch or in the wider one of a disease of contiguity, was only rarely invoked to explain the origin of an illness, and even when it was, it formed only one part, and not necessarily the most important part, of a complex of overlapping alternatives"

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1044687/pdf/medhist00001-0139.pdf 

“We know a great number of authors who wrote about the transmission of contagion by microscopic organisms … we will not waste time in refuting these absurd hypotheses.”

https://academic.oup.com/ije/article/38/1/7/698533 

Germ warfare tests

https://www.discovermagazine.com/health/blood-and-fog-the-militarys-germ-warfare-tests-in-san-francisco 

Probing the enigma of multiple personality

https://www.nytimes.com/1988/06/28/science/probing-the-enigma-of-multiple-personality.html 

Polysorbate 80

Polysorbate 80: A Risky Vaccine Ingredient

https://thevaccinereaction.org/2016/01/polysorbate-80-a-risky-vaccine-ingredient/ 

Polysorbate 80: a pharmacological study

https://pubmed.ncbi.nlm.nih.gov/4026903

Flu shot

“For by thy pharmakeia were ALL nations deceived”

https://www.pathwaytopeace.net/index.php/blogs-and-articles/pharmakeia-deception 

Science shows that whatever is injected is far more potent than anything ingested. Injections, like vaccines, bypass the body’s natural detox pathway.

https://learntherisk.org/ingredients/ 

Flu vaccine ineffective for seniors

https://murrayvillechiropractic.com/blog/shock-cdc-study-flu-vaccine-ineffective-in-91-of-seniors/

Study: Pneumococcal Vaccine for Middle-aged and Older Adults Increases Risk for Pneumonia and Death

https://vaccineimpact.com/2018/study-pneumococcal-vaccine-for-middle-aged-and-older-adults-increases-risk-for-pneumonia-and-death/

Flu shots not protecting elderly

https://www.scientificamerican.com/article/flu-shots-may-not-protect-the-elderly-or-the-very-young/

Data Shows Link Between COVID Deaths & Flu Shot Rates In Elderly 11/2/20

https://principia-scientific.com/data-shows-link-between-covid-deaths-flu-shot-rates-in-elderly/ 

The correlation between COVID-19 deaths per million of population and 65+ year olds that have received influenza vaccines is real. 11/12/20

https://qplusnews.com/correlation-coefficient-covid-deaths-qivc-flu-shots 

Facts about vaccines the government doesn't want you to know about 11/18/20

https://lbry.tv/@WakeUpMirror:3/Facts-about-vaccines-the-government-doesn't-want-you-to-know-about:b 

Flu vaccine being oversold

https://theconversation.com/amp/the-flu-vaccine-is-being-oversold-its-not-that-effective-97688 

Tamiflu & influenza vaccines: more harm than good?

https://www.bmj.com/content/368/bmj.m626/rr

Receiving influenza vaccination may increase the risk of other respiratory viruses, a phenomenon known as virus interference.

https://pubmed.ncbi.nlm.nih.gov/31607599/

FLULAVAL Vaccine “Package Insert” admits not safety tested. Glaxo writes, “[N]o controlled trials demonstrate a decrease in influenza”.

http://harvoa.org/flu/glaxo-ins.htm

Positive association between COVID-19 deaths and influenza vaccination rates in elderly people worldwide [PeerJ]

https://peerj.com/articles/10112/

We conclude that observational studies substantially overestimate vaccination benefit.

https://jamanetwork.com/journals/jamainternalmedicine/fullarticle/486407 

The influenza vaccine only gives a temporary artificial immunity

https://www.nvic.org/vaccines-and-diseases/Influenza/vaccine-effectiveness.aspx 

For community-dwelling seniors, the flu shot has not been shown to decrease hospitalizations. Evidence that the flu shot decreases mortality is likely biased.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3994812/

Last year, the flu vaccine was 37% effective against Influenza-A. That would mean that for every 3 unvaccinated persons who got the flu, 2 vaccinated ones also got it 10/8/20

http://www.1to1vitamins.com/index.php?option=com_content&view=category&layout=blog&id=8&Itemid=114 

Flu shot ingredients

https://i.postimg.cc/g23xq3M7/Flu-shot-ingredients.jpg 

Check out the (un)safety data sheet for this Triton X-100 in Fluzone

https://www.cellbiolabs.com/sites/default/files/SDS%20%28VPK-108-H%29%20GHS.pdf 

Aluminum in flu Vaccines: What Everyone Needs to Know

https://www.westonaprice.org/health-topics/vaccinations/aluminum-in-vaccines-what-everyone-needs-to-know/ 

Flu shot correlation to Alzheimers

https://i.postimg.cc/3rqwK9tM/Flu-shot-Alzheimers.jpg 

Feeling sick after the flu shot?

https://m.facebook.com/story.php?story_fbid=10157697698433576&id=502548575 

Flu shots cause positive CV test

https://i.postimg.cc/HLGLQ13p/flushot.jpg 

False-positive PCR results linked to administration of seasonal influenza vaccine

https://pubmed.ncbi.nlm.nih.gov/22096134/

The greatest risk factor for death from COVID-19 in people over 65 years of age is the fact of having received influenza vaccination with the adjuvant vaccine polysorbate 80.

https://xochipilli.files.wordpress.com/2020/06/posible-causa-pandemia-polisorbato-vacuna-gripe-actualizado_18-06-2020.pdf

A January 2020 US Pentagon study (Wolff 2020) found that the flu shot INCREASES the risks from coronavirus by 36% 8/14/20

https://childrenshealthdefense.org/news/chd-sues-the-university-of-california-over-mandatory-flu-vaccine-policy/

Increased Risk of Noninfluenza Respiratory Virus Infections Associated With Receipt of Inactivated Influenza Vaccine

https://pubmed.ncbi.nlm.nih.gov/22423139/

Correlation Coefficient COVID Deaths & QIVc Flu Shots

http://qplusnews.com/correlation-coefficient-covid-deaths-qivc-flu-shots

Is There A Flu Shot / COVID Link? – Questions For Corbett #068

https://www.corbettreport.com/is-there-a-flu-shot-covid-link-questions-for-corbett-068/ 

Influenza vaccination and respiratory virus interference among Department of Defense personnel during the 2017-2018 influenza season

https://pubmed.ncbi.nlm.nih.gov/31607599

Dose-Dependent Negative Effects of Prior Multiple Vaccinations Against Influenza A and Influenza B Among Schoolchildren:

https://academic.oup.com/cid/article/67/6/897/4924693

Increased Risk of Noninfluenza Respiratory Virus Infections Associated With Receipt of Inactivated Influenza Vaccine

https://academic.oup.com/cid/article/54/12/1778/455098

The Centres for Disease Control and Prevention (CDC) has warned parents about a life-threatening neurological condition in children that could surge again this flu season

https://www.yahoo.com/news/cdc-warns-debilitating-neurological-condition-144824968.html 

Flu shot ingredients

https://www.healthline.com/health/cold-flu/flu-shot-ingredients#ingredients

Flu Vaccines can trigger GBS

https://thevaccinereaction.org/2018/11/afm-compared-to-guillain-barre-syndrome/ 

GBS after a flu shot is similar to Chronic Inflammatory Demyelinating Polyneuropathy (CIDP)

https://ccandh.com/vaccine-injuries/guillain-barre-syndrome-gbs-flu-vaccine/ 

NIAID researchers also found that these participants were just as likely to experience some flu symptoms as those with low levels of HA antibodies

https://www.nih.gov/news-events/news-releases/nih-study-finds-factors-may-influence-influenza-vaccine-effectiveness 

Getting a flu shot 2 years in a row may result in lower vaccine effectiveness (VE) in the 2nd year

https://www.cidrap.umn.edu/news-perspective/2014/11/study-adds-more-data-effects-consecutive-year-flu-shots 

Vaccines show sinister side

http://whale.to/vaccines/woolley.html.htm

Alzheimer's and vaccination

http://whale.to/vaccines/flu11.html

From Original Antigenic Sin to the Universal Influenza Virus Vaccine - https://pubmed.ncbi.nlm.nih.gov/28867526/

Ontario Minister of Health pretends to get flu shot on TV 2019

https://www.youtube.com/watch?v=fttEVSIIPyI&feature=youtu.be 

Good news about viruses

Viruses: You've heard the bad; here's the good

https://www.sciencedaily.com/releases/2015/04/150430170750.htm

Why viruses deserve a better reputation

https://www.knowablemagazine.org/article/living-world/2018/why-viruses-deserve-better-reputation

Germs are ubiquitous

https://i.postimg.cc/0QT2CyMk/Germs-are-ubiquitous.jpg 

Your Microbes and You

https://newsinhealth.nih.gov/2012/11/your-microbes-you 

The Healthy Human Microbiome

https://www.nih.gov/news-events/nih-research-matters/healthy-human-microbiome 

Jason Tetro, microbiology researcher and author of "The Germ Files," says that some can even improve your health.

https://www.youtube.com/watch?v=QUHwcp6oPog&feature=youtu.be 

Science of Virus

The Human Genome Is FULL OF VIRUSES. Viruses are powerful, ancient, and vital to our existence, but they are extremely simple constructions. They tend to be nothing more than a few pieces: a protein capsid, which is a simplistic and protective shell; a protein called a polymerase, which carries out most of the functions related to replicating the viral genome; and a sequence of nucleotides — either RNA or DNA — that encode for the previously mentioned viral proteins. 2/4/21

https://medium.com/medical-myths-and-models/the-human-genome-is-full-of-viruses-c18ba52ac195 

JONES IS CONVINCED THAT VIRUSES AND OTHER MICROBES “SHOULD BE VIEWED AS A PART OF US RATHER THAN SOMETHING THAT LIVES IN OR ON US.” 3/1/21

https://www.sciencenews.org/article/vast-virome 

Video on science of virus 15 min

https://www.youtube.com/watch?v=_QNlrsiO-Fo&feature=youtu.be 

Original "coronavirus" paper. Please note that, as with all virus papers, they simply ASSUME that a 'virus' is there to begin with.  

https://www.ncbi.nlm.nih.gov/.../pdf/brmedj02397-0043.pdf

The Town of Allopath - A Story of Deception

https://lbry.tv/@Alin:7/The-Town-of-Allopath-A-Story-of-Deception:b 

Over 380 trillion viruses living in your body

https://i.postimg.cc/ryRPBjF1/Viruses.jpg 

Claimed images of covid particles

https://i.postimg.cc/mDDSyLh3/Claimed-pictures-of-COVl-D-virus-particles.jpg 

Science of virus

https://onedrive.live.com/view.aspx?resid=555D11E24789FD93!3558&ithint=file%2cdocx&authkey=!AAls_gxj0MIK4ec 

Purification of viruses

https://link.springer.com/content/pdf/10.1007/978-3-642-85899-4_2.pdf 

They think science means peer reviewed papers

https://m.facebook.com/story.php?story_fbid=10226149944684142&id=1504280131 

Tom Barnett 2 - 10 minute videos You can't catch a virus

https://videopress.com/v/9oO9pGlQ 

https://videopress.com/v/bySC0KAv

Language, Definitions and Logic

https://danielvanstraaten.com/language-definitions-and-logic 

Differences between in vitro, in vivo, and in silico studies

https://mpkb.org/home/patients/assessing_literature/in_vitro_studies 

Nocebo Effect

Sometimes people in a group start to think they might have been exposed to something dangerous, like a germ or a toxin (poison). They might get signs of sickness like headache, dizziness, faintness, weakness or a choking feeling. If many people in the group start to feel sick at about the same time, we might think they have mass psychogenic illness. The group might be a class in a school or workers in an office. Mass psychogenic illness is sometimes called mass hysteria or epidemic hysteria.

https://www.aafp.org/afp/2000/1215/p2655.html 

How Coronavirus Anxiety Can Make You Feel Sick How to treat psychosomatic symptoms when you are physically healthy.

https://www.psychologytoday.com/us/blog/why-bad-looks-good/202003/how-coronavirus-anxiety-can-make-you-feel-sick

Many outbreaks of mass psychogenic illness start with an environmental “trigger.” The environmental trigger can be a bad smell or a suspicious-looking substance. Or it could be something else that makes people in a group believe they have been exposed to a germ or a poison. When this happens, many of them may begin to experience symptoms of sickness at the same time. In some cases, one person gets sick and then other people in the group also start feeling sick.

https://familydoctor.org/condition/mass-psychogenic-illness/ 

How Do Nocebo Phenomena Provide a Theoretical Framework for the COVID-19 Pandemic? Always remember: Corona means crown or highest point of the body.  Virus means poison or toxin. Coronavirus = head (mind) poison That is not a coincidence. 7/20/21

https://www.researchgate.net/publication/345941264_How_Do_Nocebo_Phenomena_Provide_a_Theoretical_Framework_for_the_COVID-19_Pandemic

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7661580

The Nocebo Effect: Placebo's Evil Twin

https://www.washingtonpost.com/archive/lifestyle/wellness/2002/04/30/the-nocebo-effect-placebos-evil-twin 

Contagious thought that could kill you:

https://www.bbc.com/future/article/20150210-can-you-think-yourself-to-death

The nocebo effect and its relevance for clinical practice

By Luana Colloca, M.D., Ph.D and Franklin G. Miller, Ph.D

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3167012/

Nocebo is the Enemy, not Placebo. A Meta-analysis of Reported Side Effects After Placebo Treatment in Headaches

https://chiro.org/research/ABSTRACTS/Nocebo_is_the_Enemy.shtml

The nocebo effect: patient expectations and medication side effects Kate Faasse, Keith J Petrie

https://www.fmhs.auckland.ac.nz/assets/fmhs/som/psychmed/petrie/docs/2013-nocebo-review.pdf

The Neurobiology of Placebo and Nocebo: How Expectations Influence Treatment Outcomes

Donald Eknoyan, M.D., Robin A. Hurley, M.D., and Katherine H. Taber, Ph.D

https://neuro.psychiatryonline.org/doi/full/10.1176/appi.neuropsych.13090207

The placebo effect -- when a sugar pill or a parent's kiss makes an illness go away -- has an evil twin. The nocebo effect is the opposite of the placebo effect. It describes a situation where a negative outcome occurs due to a belief that the intervention will cause harm.

https://www.youtube.com/watch?v=wQ1QCbnUjPE 

The nocebo effect -- Helen Pilcher -- Nothing event

https://www.youtube.com/watch?v=wQ1QCbnUjPE

SURGERY, THE ULTIMATE PLACEBO 9/7/21

https://www.youtube.com/watch?v=nGOZRp8bwr4 

Movie clip

https://www.bitchute.com/video/4pJzyNCriKAF 

Scripture

1 Corinthians 6:19-20 Or do you not know that your body is a temple of the Holy Spirit within you, whom you have from God? You are not your own, for you were bought with a price. So glorify God in your body.

Jeremiah 17:14 Heal me, O Lord, and I shall be healed; save me, and I shall be saved, for you are my praise.

Revelation 18:23 “And the light of a candle shall shine no more at all in thee; and the voice of the bridegroom and of the bride shall be heard no more at all in thee: for thy merchants were the great men of the earth; for by thy sorceries were all nations deceived.”

Controlled OP

CONTROLLED OPP PROFILES (005): “DEL BIGTREE – Criminal Investigation by the L.A. County District Attorney!

https://tmatthewphillips.com/2018/03/23/controlled-opp-profiles-005-del-bigtree-criminal-investigation-by-the-l-a-county-district-attorney/ 

Covid” injection drug is being called a “vaccine”

Vaccine, at least mRNA-based, is a fancy name for a chemical compound (drug/medicine) or a chemical-based treatment – nothing more. It is a marketing gimmick for selling an irrelevant and useless product that potentially could be highly toxic because of its similarity to chemical compounds present in the body, commonly known as RNA, DNA, gene, genome, etc. 4/5/22

https://bioanalyticx.com/vaccination-and-astrology 

Dr. Jessica Rose - "I Just Told The Globalists They're Going To Fail." 9/13/22

https://odysee.com/@drsambailey:c/Dr-Jessica-Rose-I-Just-Told-The-Globalists-They're-Going-To-Fail:b 

Italian Court Orders Analysis of Covid 'Vaccines' to Determine if 'Harmful' For the first time in Italy, a court in Pesaro ruled that the contents of mRNA vaccines must be investigated. The decision comes after a 50-year-old man who has already contracted Covid and does not want to undergo the vaccine to work. However, despite already having Covid, the man was suspended due to his ‘non-compliance’ after refusing to take the jab.8/16/22

https://rairfoundation.com/ground-breaking-italian-court-orders-analysis-of-covid-vaccines-to-determine-if-harmful-video/ 

CDC admits no studies on vaccine schedule 6/30/22

https://video214.com/play/puuVH8tNUFOlYYALaPCsVg/s/dark 

1750+ COVID VaXXine Publications and Case Reports Citing Adverse Effects Post COVID VaXXination!

https://www.drrobertyoung.com/post/1750-covid-vaxxine-publications-and-case-reports-citing-adverse-effects-post-covid-vaxxination 

Pfizer CUMULATIVE ANALYSIS OF POST-AUTHORIZATION ADVERSE EVENT REPORTS OF PF-07302048 (BNT162B2) RECEIVED THROUGH 28-FEB-2021 3/3/22

https://phmpt.org/wp-content/uploads/2021/11/5.3.6-postmarketing-experience.pdf 

World Council for Health Calls for an Immediate Stop to the Covid-19 Experimental “Vaccines”

https://worldcouncilforhealth.org/campaign/covid-19-vaccine-cease-and-desist/#full 

The Myth of "Safe and Effective" Dr Sam Bailey 12/20/21

https://odysee.com/@drsambailey:c/the-myth-of-safe-and-effective:0 

US Agencies Quietly Studying Reports of Post-Vaccination Neurological Issues 2/22/22

https://www.theepochtimes.com/us-agencies-quietly-studying-reports-of-post-vaccination-neurological-issues_4262395.html 

Why You Can’t Get Pfizer’s ‘Approved’ Comirnaty Vaccine

https://childrenshealthdefense.org/defender/steve-kirsch-alix-mayer-pfizer-approved-comirnaty-vaccine/ 

Real Reason Monoclonal Antibodies Lost FDA EUA, Associate Drug Fail Safety Trial, LETHAL Side Effect 1/31/22

https://www.unite4truth.com/post/real-reason-monoclonal-antibodies-lost-fda-eua-associate-drug-fail-safety-trial-lethal-side-effect 

“Under the EUA, it is your choice to receive or not receive the vaccine. Should you decide not to receive it, it will not change your standard medical care.”

https://childrenshealthdefense.org/defender/no-one-can-force-you-pfizers-comirnaty-vaccine/ 

FDA Releases 3000 Page Report on Pfizer - Pfizer's Post Marketing Pharmacovigilance Report

https://blurt.blog/covid-19/@phusionphil/fda-releases-3000-page-report-on-pfizer-pfizer-s-post-marketing-pharmacovigilance-report 

All links regarding vaccines

https://docs.google.com/document/d/e/2PACX-1vR62sGoSODLpK6A2jCQ-hOZoaqnQwxoHadgxP6CxZ9jz_vrxqMYVI__Wi7sQbi9AoWLeCAgpg0A5UK8/pub

Why are we vaccinating children against COVID-19? 10/25/21

https://www.sciencedirect.com/science/article/pii/S221475002100161X 

Side effects and deaths from vaccine 10/25/21

https://ars.els-cdn.com/content/image/1-s2.0-S221475002100161X-ga1_lrg.jpg 

Common "Covid-19" Vaccine Side Effects: 8/26/21

https://docs.google.com/document/d/e/2PACX-1vTcyVhmz-pn_fLYKIw6FKwZN26hrwM3C7oVsbFgO73r9EG2smOpoAIrBgj0n697BoElzscyGY0oq5w4/pub

After reviewing the document production we have received the ingredients in the vaccines and subsequent animal studies are absolutely horrific. And I am not a doctor or an expert, but I can read and have common sense. The animal death rate in some of these studies was upwards of 90%.

https://nojabforme.info/ 

Pfizer lying about vax approval 8/31/21

https://www.facebook.com/TruYorker/videos/4886681811346046 

Aborted fetal cells and vaccines – a scandal much bigger than Pfizer’s whistleblower ever imagined

https://americasfrontlinedoctors.org/2/frontlinenews/aborted-fetal-cells-and-vaccines-a-scandal-much-bigger-than-pfizers-whistleblower-ever-imagined/ 

Fetal DNA and proteins are also found in the Covid-19 vaccines, at least for the ones which were developed, not just tested, in fetal cells. Genetic engineer, Dr. Theresa Deisher, explains that it is impossible to totally separate the antigen from the medium it is grown in. Listen as she explains:

https://youtu.be/2RNb4cXIPrU 

FDA Approval may give lawyers MORE AMMUNITION to fight mandates and the Pfizer injections from being pushed onto your KIDS!  The package insert reveals “criminal action”, according to Dr. Jane Ruby, who joins Stew Peters to discuss the unprecedented action taken by the FDA. 8/24/21

https://www.redvoicemedia.com/2021/08/fda-approval-illegal-doctor-reveals-pfizer-insert-proves-criminal-regulation-violations/ 

How concerned are you about adverse events related to the vaccines? 8/20/21

https://www.medscape.com/sites/public/covid-19/vaccine-insights/how-concerned-are-you-about-vaccine-related-adverse-events 

Canada health agency wont provide vaccine insert 8/23/21

https://www.bitchute.com/video/G4prtU47t1Fm/ 

PFIZER WHISTLEBLOWER KAREN KINGSTON – VACCINE INGREDIENTS 8/6/21

https://fos-sa.org/2021/07/29/pfizer-whistleblower-karen-kingston-vaccine-ingredients/ 

IA - Pfizer Whistleblower Confirms Covid Injections are Poisonous Bioweapons - Dr. Andrew Kaufman - Karen Kingston 8/6/21

https://odysee.com/@lancewdetrick:b/IA---Pfizer-Whistleblower-Confirms-Covid-Injections-are-Poisonous-Bioweapons---Dr.-Andrew-Kaufman---Karen-Kingston:d 

School and employer vaxx mandate not legal 8/4/21

https://rumble.com/vkotev-employer-school-mandated-vaxx-not-legal-attorney-says-hold-the-line.html 

Most people believe that vaccines saved us from deadly diseases. We actually don’t have any scientific evidence to prove this, but nevertheless we still believe this is the case.  

https://nateserg808.wixsite.com/my-site/post/5-bra-tips-we-wish-mom-told-us 

Why so many Americans are refusing to get vaccinated 8/18/21

http://www.skirsch.com/covid/Refuse.pdf 

Covid “Vaccines”: A Faltering Framework

https://off-guardian.org/2021/06/01/covid-vaccines-a-faltering-framework/ 

The Moderna and Pfizer vaccine tests were conducted, as customary, with a control group; a group within the trial who were given a placebo and not the test vaccine.  However, during the trial -and after the untested vaccines were given emergency use authorization- the vaccine companies conducting the trial decided to break protocol and notify the control group they were not vaccinated.  Almost all the control group were then given the vaccine. 8/9/21

https://theconservativetreehouse.com/blog/2021/08/06/this-is-nuts-moderna-and-pfizer-intentionally-lost-the-clinical-trial-control-group-testing-vaccine-efficacy-and-safety 

Dr Cowan Discussion June 1st, 2021 Covid Vaccines.mp4 6/2/21

https://www.dropbox.com/s/p0hhc6lgruquo6o/Discussion%20June%201st%2C%202021%20Covid%20Vaccines.mp4?dl=0 

The ACTUAL CONTENTS Inside Pfizer Vials EXPOSED! 7/7/21

https://rumble.com/vjgmj9-breaking-discovery-the-actual-contents-inside-pfizer-vials-exposed.html 

Thin graphene oxide sheets can translocate from the nasal cavity to the brain 7/8/21

https://www.sciencedirect.com/science/article/pii/S2666386420301879 

Seeing Through the COVID-19 Spin 8/6/21

https://www.nvic.org/nvic-vaccine-news/april-2021/covid-spin.aspx 

As much of the world rushes to receive a lightly-tested pharmaceutical product, we thought it was high time to look again at the (very) big business of medicine. Leemon McHenry, PhD, guides us to the fraudulent core of ghostwritten studies, captured legislators, revolving-door regulatory agencies, pay-to-play medical journals, and the "key opinion leaders" who lend their academic credentials to giant corporations...for a price.  7/8/21

https://www.youtube.com/watch?v=UAEAWyfuEWY 

Dr Sam takes her gloves off in this video! Watch her rebuttal against a stuff.co.nz character assassination attempt on Dr Simon Thornley. 6/1/21

https://odysee.com/@drsambailey:c/Vaccines-Lies-And-Smears-Odyssey-Comp-2:c 

Read our open letter to the chairman of the Joint-Committee on Vaccination and Immunization, Professor Andrew Pollard. 8/25/21

https://childrensunion.org/2021/08/09/open-letter-to-jcvi-chairman-on-teen-vaccination/ 

Statistical nonsense

https://i.postimg.cc/sx1JbwFC/Absolute-risk-reduction.jpg 

“If you require your employees to be vaccinated as a condition of employment (i.e., for work-related reasons), then any adverse reaction to the COVID-19 vaccine is work-related.

https://www.natlawreview.com/article/osha-releases-guidance-employers-considering-vaccine-requirements 

https://www.osha.gov/coronavirus/faqs#vaccine 

Federal Law Prohibits Mandates of Emergency Use COVID Vaccines, Tests, Masks — 3 Resources You Can Use to Inform Your School or Employer Under federal law, employers and universities cannot legally mandate COVID vaccines because they are unlicensed Emergency Use Authorization products which are, by definition, experimental.

https://childrenshealthdefense.org/defender/resources-federal-law-prohibits-mandates-emergency-use-covid-vaccines-tests-masks 

https://i.postimg.cc/sfp6d0Zs/Employer-obligations.jpg 

Vaccines have become one of the most polarizing issues of the day. There is an aggressive push by lawmakers to force everyone to become vaccinated, as well as intense hostility by many vaccine supporters towards those who question the efficacy and safety of vaccines.

http://www.vaccinesandchristianity.org/2019/01/31/vaccine-pandemic-part-4-the-medical-professions-legacy-of-tyranny-torture-and-murder/ 

COVID-19 vaccine efficacy and effectiveness—the elephant (not) in the room: 6/2/21

https://www.thelancet.com/journals/lanmic/article/PIIS2666-5247(21)00069-0/fulltext

Like almost all parents, these families seek to safeguard the long-term health of their children. Unlike most parents, they have concluded that avoiding vaccines confers an overall health benefit for their children. While there is an abundance of evidence to support this conclusion, the most compelling evidence are the health outcomes of their children as compared with the health outcomes of the vaccinated children in their school districts.

https://drive.google.com/file/d/1KUFQbtZgKwt9dxiGhyRz4SC28je57-rB/view 

The Great Vaccine Con shows without a shadow of doubt once and for all what many of us have suspected and others already knew that vaccines are neither safe nor effective. The claim they are the greatest medical breakthrough of our time is nothing but a total Con that’s been covered up for decades on a public that is becoming less and less gullible and harder to convince. Expose on how the vaccine industry has been involved in a large scale vaccine medical fraud. Plus it’s desperate attempts to cover up the millions of vaccine injuries and the trillions the industry will have to pay out in the future in compensation.

https://www.thegreatvaccinecon.com/ 

There is no scientific evidence to show that vaccines are safe and effective, but we do know that after the introduction of vaccines, the death rates attributed to these diseases plummeted.  But there is an inherent problem with this logic.

https://nateserg808.wixsite.com/my-site/post/5-bra-tips-we-wish-mom-told-us 

COVID vaccine and genetic thunder nobody is listening to 5/18/21

https://blog.nomorefakenews.com/2021/05/18/covid-vaccine-and-genetic-thunder-nobody-is-listening-to/ 

Vaccine shedding webinar 5/18/21

https://lbry.tv/@Truth_will_set_You_Free:0/Vaccine-Shedding-Webinar:a 

J&J vaccine ingredient package is totally blank which is illegal.

https://m.facebook.com/story.php?story_fbid=116812737210094&id=100066441045581 

The COVID Jab, a Genocidal Weapon of Mass Destruction 5/12/21

https://www.educationviews.org/the-covid-jab-a-genocidal-weapon-of-mass-destruction/ 

Outcome Reporting Bias in COVID-19 mRNA Vaccine Clinical Trials. Pfizer and Maderna are using risk reduction in order to claim 95% effective instead of absolute risk where they would only be able to claim .7% effective and .6% effective which is right out of the book, How to Lie with Statistics.

https://pubmed.ncbi.nlm.nih.gov/33652582/ 

Why Are Cytotoxic Carbon NanoTubes or NanoWorms Found In mRNA Vaccines?

https://www.drrobertyoung.com/post/why-are-cytotoxic-carbon-nanotubes-or-nanoworms-found-in-mrna-vaccines 

Vaccines & The Law

https://www.americasfrontlinedoctors.org/legal/vaccines-the-law 

Form for Employees Whose Employers Are Requiring Covid-19 Injections

https://www.coreysdigs.com/solutions/form-for-employees-whose-employers-are-requiring-covid-19-injections/ 

Form for employer

https://69ae7b91-ba0b-4f2d-9c1d-f6a3a54cb91d.filesusr.com/ugd/225517_180e5e8b1aa34bf2a40575e98743c4f0.pdf 

Federal law prohibits employers and others from requiring vaccination with a Covid-19 vaccine distributed under an EUA 5/6/21

https://www.statnews.com/2021/02/23/federal-law-prohibits-employers-and-others-from-requiring-vaccination-with-a-covid-19-vaccine-distributed-under-an-eua/ 

Brainwashing surrounding vaccines 4/16/21

https://www.bitchute.com/video/Tub5Z2eOFw61/ 

A Comparison of Plasmid DNA and mRNA as Vaccine Technologies 4/15/21

https://docs.google.com/document/d/e/2PACX-1vSjGdAuz7ylrerc_9rtcA-sstCzHPrGn2Zrh0eG1ZWfoMsHvWeXQ9W3xR-D2uaSUmcUG41xQa-mFPWh/pub 

According to the CTIAP, all of the vaccines were put on the market and actively used on human beings before “proof of quality for the active substance and the finished product” was produced: all the manufacturing labs obtained future deadlines to submit their studies in this regard. 5/5/21

https://www.lifesitenews.com/news/french-drug-assessment-center-demands-removal-of-all-four-widely-used-covid-vaccines 

“Prudence would even dictate that, in all countries where these vaccines against COVID-19 have been marketed, all the batches thus ‘released’ should be withdrawn immediately; and that these MAs that have been granted should be suspended, or even canceled, as a matter of urgency until further notice.”

https://www.globalresearch.ca/french-drug-assessment-center-demands-removal-all-four-widely-used-covid-vaccines/5743512 

The goal of this Family Financial Form is ensure that an adverse event or death of one family member does not translate into long-lived or permanent financial destruction for the entire family. This form was created to assist families to communicate regarding and to prepare for the family-wide financial impact of adverse events, if any, resulting from a Covid injection. 3/15/21

https://pandemic.solari.com/wp-content/uploads/2021/03/FAMILY-FINANCIAL-DISCLOSURE-FORM-FOR-COVID-19-INJECTIONS-Fixed.pdf 

https://pandemic.solari.com/family-financial-disclosure-form-for-covid-19-injections/

Those who promote these gene therapies, falsely called 'vaccines,' are sorcerer's apprentices and take Italians and other citizens of the world as guinea pigs.

https://www.churchmilitant.com/news/article/doctors-reject-experimental-covid-19-vaccine 

Moderna’s top scientist: ‘We are actually hacking the software of life’ 3/12/21

https://leohohmann.com/2021/03/09/modernas-top-scientist-we-are-actually-hacking-the-software-of-life/ 

Interim roadmap assessment: prior to Step 2 Rosanna Barnard, Nick Davies, Mark Jit, John Edmunds London School of Hygiene & Tropical Medicine 31 March 2021 Summary We model the stages of the UK Government’s “Roadmap” for reopening in terms of increases to population mobility that may be expected to result at each stage; increases to population mobility are based upon previously-observed mobility patterns during comparable periods of movement restrictions from 2020. Our projections suggest that Step 2 alone may lead to a small surge of cases and deaths, and that Step 4 may lead to a larger surge of cases and deaths comparable to that seen during the first wave. However, we caution that this work is preliminary and makes pessimistic assumptions about the impact of Step 4 which require further work to refine.

https://assets.publishing.service.gov.uk/government/uploads/system/uploads/attachment_data/file/975912/S1185_LSHTM_Interim_roadmap_assessment_prior_to_Step_2.pdf

US officials publicly question AstraZeneca’s COVID-19 vaccine data 3/24/21

https://www.theverge.com/2021/3/23/22346135/covid-vaccine-us-astrazeneca-niaid-statement-concerns 

Dr Drew says those getting vaccinated are agreeing to be euthanized

https://www.facebook.com/688628359/posts/10159015635138360/ 

12 “vaccine” truths

https://files.constantcontact.com/15c678ac701/c8c9d914-6958-4716-a9b2-7f28e5fe3a84.pdf 

Advertising and Marketing Controversies, corporate rap sheet resulting in major fines

https://www.corp-research.org/astrazeneca 

Four of the six are convicted – not accused of or suspected of – but convicted of criminality ranging from falsifying research, the bribing of doctors, regulators, legislatures, and even law enforcement officials, to the marketing of drugs to children for conditions not approved of by regulators, and false advertising – just to mention a few.

https://www.globalresearch.ca/real-problem-covid-19-vaccines/5721737 

If you think vaccines are safe, consider these things

https://steemit.com/health/@johnblaid/if-you-think-vaccines-are-safe-consider-these-things 

Dr. Lorraine Day exposes evil agenda behind COVID-19 vaccines 4/8/21

https://z3news.com/w/dr-lorraine-day-exposes-evil-agenda-covid19-vaccines/ 

None of the injections have received FDA approval 3/12/21

https://www.pfizer.com/news/hot-topics/the_facts_about_pfizer_and_biontech_s_covid_19_vaccine

https://www.modernatx.com/covid19vaccine-eua/recipients/moderna-vaccine

https://www.fda.gov/media/146305/download

https://www.fda.gov/emergency-preparedness-and-response/coronavirus-disease-2019-covid-19/janssen-covid-19-vaccine

"The two mRNA vaccines that are authorized for the disease are highly effective. They have been known to evoke other side effects like low-grade fever, chills, headaches and fatigue."

https://www.yahoo.com/news/side-effect-covid-19-vaccine-163215589.html 

When you accept the shot, you then authorize them to include you as part of the experiment

https://www.bitchute.com/video/xG99Cx6i4t1U/ 

Experimental mRNA Gene Therapy Covid-19 3/8/21

https://drtrozzi.com/2021/01/this-is-not-a-vaccine 

Federal law prohibits employers and others from requiring vaccination with a Covid-19 vaccine distributed under an EUA 3/22/21

https://www.statnews.com/2021/02/23/federal-law-prohibits-employers-and-others-from-requiring-vaccination-with-a-covid-19-vaccine-distributed-under-an-eua/ 

Dissecting the Vaccine with Dr Andy Wakefield 3/13/21

https://lbry.tv/@Alin:7/Dissecting-the-Vaccine-with-Dr-Andy-Wakefield:b 

501 Deaths + 10,748 Other Injuries Reported Following COVID Vaccine, Latest CDC Data Show 2/7/21

https://childrenshealthdefense.org/defender/deaths-injuries-following-covid-vaccine-cdc/ 

WHAT'S REALLY IN THE FAKE 'VACCINES - FORMER FEMA EMPLOYEE CELESTE SOLUM

https://lbry.tv/@DavidIcke:6/must-watch-what-x27-s-really-in-the-fake-x27-vaccines-former-fema-employee-celeste-solum-with-david-icke:7 

The linkage might seem tenuous and crude, but social theorists working for the military allegedly gained valuable insights on Covid “vaccine” adoption among segments of the population based on hoarding behavior displayed during the media-generated run on toilet paper last year. The conclusion was that the people who erratically and selfishly emptied the shelves of paper were also likely to seize the opportunity for a free jab, without thinking through the consequences or investigating even the ingredients. 3/22/21

https://www.coreysdigs.com/health-science/jab-wannabes-get-the-bums-rush/ 

WHAT'S REALLY IN THE INJECTIONS 3/3/21

https://i.postimg.cc/j2nQBMHL/Whats-really-in-the-injection.jpg 

Pfizer ingredients

https://www.cvdvaccine.ca/files/Canadian%20Patient%20Medication%20Information.pdf 

Hydrogel Biosensor: Implantable Nanotech to be Used in COVID Vaccines? 3/8/21

https://thefreedomarticles.com/hydrogel-biosensor-darpa-gates-implantable-nanotech-covid-vaccine 

Pfizer history 3/4/21

https://i.postimg.cc/bJWFGDLS/Pfizer.jpg 

Media Hails New J&J Vaccine, Ignores Pharma Giant’s ‘Checkered Past’ 3/5/21

https://childrenshealthdefense.org/defender/media-ignores-jj-pharma-giants-checkered-past 

C. V.  [Reports of Injury and Death] 3/5/21

https://prezi.com/i/zehglqhnnnt2/the-mega-compilation 

Opinion: The Biggest COVID-19 Vaccine Skeptics? Frontline Health Care Workers 3/15/21

https://www.theepochtimes.com/the-biggest-covid-19-vaccine-skeptics-frontline-health-care-workers_3724145.html 

DR. SHERRI TENPENNY: MANDATORY VACCINATION OF ADULTS WAS ALREADY PLANNED IN 2010 3/22/21

https://www.bitchute.com/video/j4feVkUWgE1n 

10 questions you must know if you are considering getting the injection

https://i.postimg.cc/DydBhMVX/10-Things-you-must-know-about-vaccines.jpg 

Analysis by infectious disease specialist claims mismatch between data published by authorities and reality on the ground. 3/3/21

https://www.israelnationalnews.com/News/News.aspx/297051 

Stanley Plotkin, Vaccines Deposition, Under Oath, 9 Hour Full VideoAborted fetal tissues are used in vaccines. Vaccines have been experimentally tested on orphans and on mental handicapped children. Experimental tests on babies from mothers in prisons. Experimental tests on 1 million people in then colonial Belgian Congo. 2/7/21

https://www.youtube.com/watch?v=DFTsd042M3o&feature=youtu.be 

OK, you’re probably thinking that doesn’t make much sense, this crusade to vaccinate the entire species against a relatively standard respiratory virus, but that’s just because you are still thinking critically. 2/27/21

https://www.globalresearch.ca/vaccine-disinformation-war/5738238?utm_campaign=magnet&utm_source=article_page&utm_medium=related_articles 

An Evidence Review from the Penn Medicine Center 2/25/21

http://www.uphs.upenn.edu/cep/COVID/mRNA%20vaccine%20review%20final.pdf 

The Covid Vaccine On Trial: If You Only Knew 2/15/21

https://childrenshealthdefense.org/webinar/the-covid-vaccine-on-trial-if-you-only-knew-watch-now/ 

Moderna’s COVID Vaccine Is An ‘Operating System’ – Is This Transhumanism? 3/6/21

https://principia-scientific.com/modernas-covid-injection-is-an-operating-system-is-this-transhumanism/ 

CDC CAUGHT SHAVING DEATH'S FROM THE VAERS SYSTEM! 3/5/21

https://www.bitchute.com/video/IusxOn0sWL59 

VAERS Data: New Website To Track/ Search Vaccine Adverse Events & Export Reports 1/27/21

https://www.youtube.com/watch?v=gIF3LjOCL4g&feature=youtu.be 

This is not a vaccine. | The Wall Will Fall 1/30/21

https://www.marktaliano.net/this-is-not-a-vaccine-the-wall-will-fall/ 

People who have received a Covid-19 vaccine could still pass the virus on to others

https://www.bbc.com/news/uk-55784199 

If they haven’t isolated the virus, how can they make a vaccine? 1/27/21

https://blog.nomorefakenews.com/2021/01/27/how-can-they-make-covid-vaccine-if-no-isolated-virus/ 

Hypersensitivity to SARS-CoV components was induced. Caution in proceeding to application of a SARS-CoV vaccine in humans is indicated. 2/23/21

https://pubmed.ncbi.nlm.nih.gov/22536382/ 

Vaccine not proven to  prevent infection 1/26/21

https://www.bitchute.com/video/NTlTg7R8upjk/ 

DNA template used does not come from isolated virus of infected person 12/31/20

https://i.postimg.cc/0yM5JSWM/Origin-of-genomic-sequence-of-m-RNA-material-in-Pfizer-vaccine.jpg 

The science of mRNA vaccines Dr Tom Cowan 1/21/21

https://www.bitchute.com/video/w22p0BrQCLBT/ 

Did you know what’s in COVID-19 Vaccines? Lung cells lines (ChAdOx1-S recombinant) from a 14-week old white male

https://www.bitchute.com/video/AmUWT3xEZt7F/ 

New Study: Diseases Declined Long Before Related Vaccines Implemented 12/28/20

http://orbisvitae.com/mc/Immunization-Graphs/ 

A brilliant analysis of vaccination, by Richard Moskowitz, MD and homeopath

https://blog.nomorefakenews.com/2020/12/24/a-brilliant-analysis-of-vaccination-by-richard-moskowitz-md-and-homeopath/ 

Medical Drs around the world speak out against vaccines 12/21/20

https://www.bitchute.com/video/fX8UtOI3wjTR/ 

Why you shouldn’t believe the COVID drug is effective 12/21/20

https://blog.nomorefakenews.com/2020/12/21/why-you-shouldnt-believe-the-covid-vaccine-is-effective/ 

There have been many fake Covid-19 jabs caught on camera; here is a compilation of some of the best. 12/28/20

https://rumble.com/vc5ysb-why-do-they-have-to-fake-it-to-convince-you-to-take-it.html 

The safety of vaccines 12/28/20

https://steemit.com/health/@johnblaid/if-you-think-vaccines-are-safe-consider-these-things 

https://m.facebook.com/photo.php?fbid=4239652472716940&id=100000166871791&set=a.228668757148685&source=48&ref=m_notif&notif_t=group_r2j_approved 

Sorceries are phamakeia

https://i.postimg.cc/43hNJM76/Pharmakeia.jpg 

Forego the vaccine

https://i.postimg.cc/8cxGt9fh/Forego-vaccine.jpg 

The Injection Fraud – It’s Not a Vaccine

https://home.solari.com/deep-state-tactics-101-the-covid-injection-fraud-its-not-a-vaccine/ 

342 NHS Staff Members Join Anti-Vax Facebook Group Claiming Coronavirus Vaccine a 'Poison' 11/16/20

https://www.ibtimes.sg/342-nhs-staff-members-join-anti-vax-facebook-group-claiming-coronavirus-vaccine-poison-53388 

CONTROVERSY AROUND ADJUVANTS IN VACCINES

https://odysee.com/@The_HighWire_with_Del_Bigtree:4/CONTROVERSY-AROUND-ADJUVANTS-IN-VACCINES:3 

FDA announces deaths of two Pfizer vaccine trial participants 12/8/20

https://www.jpost.com/breaking-news/two-individuals-die-from-pfizer-vaccine-651488 

Ask The Experts (Covid-19 Vaccine) 12/7/20

https://brandnewtube.com/watch/ask-the-experts-covid-19-vaccine-now-banned-on-youtube-and-facebook_qIsNohSIeSgfz2J.html 

The vaccines will not cure Covid The vaccines will not prevent people from contracting Covid The vaccines will not prevent Covid-related hospitalizations The vaccines will not prevent Covid-caused deaths 12/4/20

https://principia-scientific.com/heres-why-you-should-skip-the-covid-vaccine/ 

The types of vaccine being developed, such as the MRNA and chimpanzee adenovirus are relatively new, MAKING IT HARD TO PREDICT HOW THEY WILL INTERACT WITH MILLIONS OF PEOPLE'S IMMUNE SYSTEMS. 11/25/20

https://www.healthcareitnews.com/news/emea/uk-use-ai-covid-19-vaccine-side-effects 

Covid-19 vaccines: Should we allow human challenge studies to infect healthy volunteers with SARS-CoV-2? 11/25/20

https://www.bmj.com/content/371/bmj.m4258/rr 

There is an implied faith here that if a new drug manufacturer has paid for the research for FDA approval, then it is scientifically proven to be effective. As it turns out, this belief is by no means fully justified.

https://www.huffpost.com/entry/the-mythology-of-science_b_412475 

Many people who are vaccinated against COVID19 will likely suffer from “Disease Enhancement” 11/4/20

https://jameslyonsweiler.com/2020/11/03/fauci-just-tanked-the-covid19-vaccine-program-and-no-one-noticed

Researchers Warn Some Covid-19 Vaccines Could Increase Risk Of HIV Infection

https://www.forbes.com/sites/roberthart/2020/10/20/researchers-warn-some-covid-19-vaccines-could-increase-risk-of-hiv-infection/?sh=2afc4ea43740

COVID-19 Vaccine Trials Rigged To Pass Efficacy Test 11/2/20

https://principia-scientific.com/covid-19-vaccine-trials-rigged-to-pass-efficacy-test/ 

The Flawed COVID-19 Vaccine Testing Programs 11/2/20

https://www.globalresearch.ca/flawed-covid-19-vaccine-testing-programs-moderna-pfizer-johnson-johnson-astrazeneca/5728279 

Each of these vaccines had side effects in trials such as fatigue, fever, headache, muscle pain, or pain at the injection site. 11/10/20

https://www.newsroom.co.nz/be-prepared-for-covid-19-vaccine-side-effects 

COVID-19: Vaccine 'Not Possible' for a Virus Not Yet Quantifiable

https://principia-scientific.com/covid-19-vaccine-not-possible-for-a-virus-not-yet-identified/

The Sordid History of Vaccines & COVID-19

https://thetruthaboutcancer.com/sordid-history-vaccines-covid-19/ 

Is a Coronavirus Vaccine a Good Idea? Dr Wakefield

https://www.westonaprice.org/podcast/239-is-a-coronavirus-vaccine-a-good-idea/

Irrefutable Evidence Shows Historical Application of Vaccines Had No Health Benefit or Impact on Prevention of Infectious Disease 8/20/20

https://preventdisease.com/news/13/052413_Irrefutable-Evidence-Historical-Application-Vaccines-No-Health-Benefit-Impact-on-Prevention-Infectious-Disease.shtml

Biblical Health and Wellness: What Does the Bible Say About Vaccines?

http://biblicalwellness.blogspot.com/2013/08/what-does-bible-say-about-vaccines.html

A Biblical Critique of Vaccines: Part 4: Natural Food versus Unnatural Vaccine Ingredients – Vaccines and Christianity

https://www.vaccinesandchristianity.org/2020/02/08/a-biblical-critique-of-vaccines-part-4-natural-food-versus-unnatural-vaccine-ingredients/

How To Legally Avoid Unwanted Immunizations Of all kinds

https://drive.google.com/file/d/1lbrZbEniXlW4z6wLyAlPwU1O9rDl-rm8/view

There’s a new federal court to handle all the expected COVID vaccine-injury claims 9/21/20

https://blog.nomorefakenews.com/2020/09/21/exposed-new-federal-court-to-handle-expected-covid-vaccine-injury-claims 

The language that establishes the new COVID vaccine court is found in the Federal Register, 3/17/20, buried in section 14 of a document titled 9/21/20

https://www.federalregister.gov/documents/2020/03/17/2020-05484/declaration-under-the-public-readiness-and-emergency-preparedness-act-for-medical-countermeasures 

How CDC/WHO will fake the effects of the COVID vaccine to make it look like a success 9/22/20

https://blog.nomorefakenews.com/2020/09/22/how-cdc-will-fake-effects-of-covid-vaccine-make-it-look-like-success/ 

COVID vaccine clinical trials doomed to fail; fatal design flaw 9/24/20

https://blog.nomorefakenews.com/2020/09/24/covid-vaccine-clinical-trials-doomed-to-fail-fatal-design-flaw/ 

The government must heed the lessons from history on rushed vaccinations 10/4/20

https://www.independent.co.uk/news/health/coronavirus-vaccine-pandemic-swine-flu-covid-a9693721.html

David Oliver: Vaccination skeptics are immune to debate

https://www.bmj.com/content/365/bmj.l2244/rr-18

A Sars-Cov2 vaccine – don’t hold your breath | Dr. Malcolm Kendrick 10/12/20

https://drmalcolmkendrick.org/2020/10/10/a-sars-cov2-vaccine-dont-hold-your-breath/

Operation Warp Speed is Using a CIA-Linked Contractor to Keep Covid-19 Vaccine Contracts Secret 10/19/20

https://www.thelastamericanvagabond.com/operation-warp-speed-is-using-a-cia-linked-contractor-to-keep-covid-19-vaccine-contracts-secret/

Why the need for a vaccine?

https://i.postimg.cc/B6qftxgR/Vaccine.jpg 

20 Volunteers Suffer Serious Reactions to Johnson & Johnson’s COVID-19 Vaccine 10/16/20

https://thevaccinereaction.org/2020/10/20-volunteers-suffer-serious-reactions-to-johnson-johnsons-covid-19-vaccine/

Stick your vaccine up your arse’ the Covid-19 vaccine, the science and the skeptics 10/21/20

https://www.irishtimes.com/life-and-style/health-family/stick-your-vaccine-up-your-arse-the-covid-19-vaccine-the-science-and-the-sceptics-1.4382014

Malcolm Kendrick is a Scottish doctor and author of The Great Cholesterol Con Yes, a remarkable ninety per cent. Not sixty percent, not seventy percent, no…not even eighty per cent. But ninety of your finest American percent – of things’. 11/12/20

https://drmalcolmkendrick.org/author/drmalcolmkendrick/ 

How COVID-19 Vaccine Trials Are Designed 11/12/20

https://www.globalresearch.ca/selected-articles-how-covid-19-vaccine-trials-are-designed/5729231 

A careful reading reveals that the minimum qualification for a case of Covid-19 is a positive PCR test and one or two mild symptoms. Includes headache, fever, cough, or mild nausea. These vaccine trials are testing to prevent common cold symptoms. 11/12/20

https://principia-scientific.com/covid-19-vaccine-protocols-reveal-that-trials-are-designed-to-succeed/ 

The government wants you to take the experimental COVID vaccine, whose “effectiveness” was designed to prevent nothing worth losing a night’s sleep over. 11/12/20

https://blog.nomorefakenews.com/2020/11/11/covid-vaccine-revelation-sinks-like-a-stone-disappears 

Covid-19 vaccine may have unpleasant side effects. That will mean it's working 11/12/20

https://www.yahoo.com/news/covid-19-vaccine-may-unpleasant-100438136.html 

How they’ll fake the success of the COVID vaccine 11/14/20

https://blog.nomorefakenews.com/2020/11/13/how-theyll-fake-the-success-of-the-covid-vaccine/ 

Will covid-19 vaccines save lives? Current trials aren’t designed to tell us 11/16/20

https://www.bmj.com/content/371/bmj.m4037 

A mass use of this technology could change the genetic makeup of mankind irreversibly, for generations to come. 11/16/20

https://www.dr-rath-foundation.org/2020/11/compulsory-vaccination-the-next-step-for-covid-19 

Pfizer’s Experimental Covid-19 Vaccine—What You’re Not Being Told 11/19/20

https://unlimitedhangout.com/2020/11/reports/pfizers-experimental-covid-19-vaccine-what-youre-not-being-told 

"Other than common side effects of any vaccine – such as low-grade fever, soreness at the site of the injection or slight fatigue – there are some RARE BUT SERIOUS SIDE EFFECTS that include an immediate allergic reaction, OR AN INCREASE IN RISK OF DEVELOPING COVID-19 IF EXPOSED TO THE VIRUS AFTERWARDS." 11/30/20

https://www.henryford.com/moderna-vaccine/faqs 

Public needs to prep for vaccine side effects 11/30/20

https://science.sciencemag.org/content/370/6520/1022.full 

What’s all the fuss about the COVID-19 Vaccine?“MRC-5 (Medical Research Council cell strain 5) is a diploid cell culture line composed of fibroblasts, originally developed from the lung tissue of a 14-week-old aborted male fetus. 12/3/20

https://going-postal.com/2020/11/whats-all-the-fuss-about-the-covid-19-vaccine/ 

Peruvian Doctors for the Truth have issued a short video, explaining the enormous risks of the three different types of vaccines currently on the market in Peru 12/4/20

https://www.globalresearch.ca/breaking-fda-approved-drug-ivermectin-inhibits-replication-sars-cov-2-nobody-talks-about-it/5731124 

Unlike the flu vaccine, which is one shot, both covid vaccines require two shots given three to four weeks apart. Hidden toward the end of both announcements, were the definitions of “effective.” 12/4/20

https://www.globalresearch.ca/what-covid-vaccine-hype-fails-mention/5730504 

WHO Technical Advisory Group (TAG) on Behavioural Insights & Sciences for Health held a special meeting w/ the WHO Department of Immunization, Vaccines & Biologicals to discuss behavioural considerations in relation to COVID-19 #vaccine #acceptance & uptake." 12/7/20

https://threadreaderapp.com/thread/1335655158215286784.html 

Want science on vaccines, here it is.  Worth the few minutes for educational purposes.

https://www.facebook.com/steve.siergjuk/videos/10159389513010639 

UKMFA Open Letter to MHRA, JCVI and Matt Hancock regarding the Covid-19 Vaccine Rollout

https://uploads-ssl.webflow.com/5fa5866942937a4d73918723/5fbd13488af2de09d68bd61c_UKMFA_Letter_to_MHRA_JCVI.pdf 

How will the FDA account for potentially biased conclusions about COVID-19 vaccine efficacy?

https://childrenshealthdefense.org/wp-content/uploads/CHD_Letter_FDA_Dr_Marks.pdf 

Vaccine shot through shirt?

https://i.postimg.cc/t4fXgVbc/Fake-vaccine-shot.jpg 

New Quality-Control Investigations on Vaccines: Micro- and Nanocontamination

http://medcraveonline.com/IJVV/IJVV-04-00072.php 

FDA Admits COVID Vaccine Could Enhance The Virus, Making It More Deadly

https://theresistance.video/watch?id=5fed3c41ac8ab41f80f9e4d2 

CDC / FDA'S VAERS SYSTEM FREE COVID-19 ADVERSE EFFECTS DOWNLOAD

https://www.bitchute.com/video/15O9yCXDTAek/ 

Overview of the vaccine industry and Gates 1/11/21

https://www.bitchute.com/video/uqu5rR8JK5YV/ 

Vaccines to address what

https://i.postimg.cc/ZYV2KXbw/Vaccines-to-address-what.jpg 

In a nutshell, the trial designs are such that the vaccines will get a passing grade even if their efficacy is minimal.

https://truthcomestolight.com/dr-joseph-mercola-how-covid-19-vaccine-trials-are-rigged/ 

Dr. Andrew Moulden: Learning to Identify Vaccine Damage

http://www.livingforlonger.com/dr-andrew-moulden-learning-to-identify-vaccine-damage 

The following is a large collection of personal experiences.  Anecdotal evidence does not comprise the entirety of our scientific knowledge on the subject. 1/25/21

https://prezi.com/i/byzl22mqwfaa/experiences-following-cvv/ 

Drs and experts advise against taking experimental shot 2/24/21

https://i.postimg.cc/7LdKTrmt/Capture.jpg 

Pfizer ingredients

https://www.cvdvaccine.ca/files/Canadian%20Patient%20Medication%20Information.pdf 

https://en.wikipedia.org/wiki/ALC-0315 

https://en.wikipedia.org/wiki/ALC-0159 

But Vanden Bossche bases his views on unproven hypotheses. This is similar to, and builds on, high-profile modeling-paper authors who use theoretical frameworks to inflame fears about the supposed dangerousness of the new variants.3/18/21

https://www.rosemaryfrei.ca/the-curious-case-of-geert-vanden-bossche/ 

J&J Vaccine Producer Grilled at House Hearing on Botched Vaccine Doses, Lavish Executive Bonuses, Stock Sales 5/21/21

https://childrenshealthdefense.org/defender/vaccine-producer-hearing-botched-doses-executive-bonuses-stock-sales/ 

Purchaser further acknowledges that the long-term effects and efficacy of the Vaccine are not currently known and that there may be adverse effects of the Vaccine that are not currently known. 8/2/21

https://off-guardian.org/2021/07/29/covid-vaccines-the-leaked-pfizer-contract/ 

Disease decline 1 8/5/21

https://i.postimg.cc/2yzR2QVX/Disease-decline1.jpg 

Disease decline 2  8/5/21

https://i.postimg.cc/sxwF8MWf/Disease-decline2.jpg 

Drs quotes on vaccines

https://mobidrive.com/sharelink/w/35csCcMAG3MoQOunQkfY0K4EMuJjxRuYaRpbVYLGslNl 

Protein Therapy

SCIENTIFIC BASIS FOR XON-SPECIFIC PROTEIN THERAPY.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2316213/pdf/brmedj06254-0009.pdf 

“A Shot Heard Around the World,” is a compilation of information predominately coming from original sources, scientific journals, medical journals, peer reviewed studies, lawsuit filings, original letters, and includes direct links to the CDC, FDA, clinical trials, and manufactures own reports.

https://www.perk-group.com/shot-heard/a-shot-heard-around-the-world 

Koch Postulates

Medical Definition of Koch Postulates

https://www.medicinenet.com/script/main/art.asp?articlekey=7105 

What are Kochs Postulates?

https://www.rawfoodexplained.com/contagion-epidemics/kochs-postulates.html 

Scientists Have Utterly Failed to Prove that the Coronavirus Fulfills Koch’s Postulates

https://off-guardian.org/2020/06/09/scientists-have-utterly-failed-to-prove-that-the-coronavirus-fulfills-kochs-postulates/

Koch’s postulates in the 21st century

https://www.virology.ws/2010/01/22/kochs-postulates-in-the-21st-century/

Biology Professor Dr. WhitneyHolden describes Koch's Postulates

https://www.youtube.com/watch?v=xhLmZ3WMCt0&feature=youtu.be 

KOCH'S POSTULATES: HAVE THEY BEEN PROVEN FOR VIRUSES? DR. KAUFMAN

https://www.bitchute.com/video/eVa6ZMMvvwoH 

The current RKI reports on COVID-19 even show that the majority or the vast majority of cases are incorrectly designated as SARS-CoV-2 positive. 8/22/20

https://multipolar-magazin.de/artikel/das-schweigen-der-viren

PCR: Ein DNA-Test wird zum Manipulations- instrument – Telegraph

https://telegra.ph/PCR-Ein-DNA-Test-wird-zum-Manipulationsinstrument-06-28

ZERO Evidence that COVID Fulfills Koch's 4 Germ Theory Postulates -

https://www.greenmedinfo.com/blog/zero-evidence-covid-fulfills-kochs-4-germ-theory-postulates-dr-andrew-kaufman-say

Has SARS-CoV2 been isolated, purified and demonstrated to be the cause of COVID19?

https://www.researchgate.net/post/Has_SARS-CoV2_been_isolated_purified_and_demonstrated_to_be_the_cause_of_COVID19

Virus Isolation

IGNORING THE BASIC RULES OF SCIENCE - COVID-19 10/22/20

https://www.youtube.com/watch?v=aD-oFw6PW7U 

This episode is a deep dive into the crisis of truth and quality control in science and, particularly, the field of medical science. Or should that be "science"?

https://truthiverse.com/27 

Have viruses been isolated?

http://www.davidpratt.info/roberts.htm#r3 

The ‘virus‐like particles’ described in several organs have been highly contested. Because most electron microscopists in pathology are not accustomed to analyzing viral particles and subcellular structures

https://onlinelibrary.wiley.com/doi/10.1111/his.14264 

Isolation versus Purification David Crowe

https://theinfectiousmyth.com/coronavirus/IsolationVersusPurification.php

What mainstream science calls viruses

https://i.postimg.cc/QxZwMgdm/Virus.jpg 

Corona virus not yet isolated and proven

https://cairnsnews.org/2020/04/28/corona-virus-not-yet-isolated-and-proven/

Virus isolation is a very specific method for diagnosis of viral infection

https://www.sciencedirect.com/topics/immunology-and-microbiology/virus-isolation

Appropriate isolation methods are essential for unraveling the relative contribution of extracellular vesicles

https://www.researchgate.net/publication/320989294_Ultrafiltration_combined_with_size_exclusion_chromatography_efficiently_isolates_extracellular_vesicles_from_cell_culture_media_for_compositional_and_functional_studies 

The ongoing outbreak of the recently emerged novel coronavirus (2019-nCoV) poses a challenge for public health laboratories as virus isolates are unavailable 8/20/20

https://www.eurosurveillance.org/content/10.2807/1560-7917.ES.2020.25.3.2000045

Antibiotics in Cell Culture - What types are available and when and how to utilize them - Cell Culture Dish

https://cellculturedish.com/which-are-all-the-antibiotics-can-be-used-in-combination-in-large-scale-vero-cell-culture-and-at-what-concentration-2/

Asking a mainstream geneticist whether the COVID virus has been proven to exist is very much like asking a news anchor whether he reports the facts every night. 10/16/20

https://blog.nomorefakenews.com/2020/10/16/but-i-spoke-with-my-virologist-friend-and-he-said/ 

Misinterpretation of the virus courses

Misinterpretation of the virus / covid-19 / ENGLISH *premiere* 10/7/20

https://www.youtube.com/watch?v=8-hSdSDUw68 

Misinterpreted virus Lanka

https://i.postimg.cc/wMJcG9kr/Misinterpreted-viruses-Lanka.jpg 

We are a small group of independent filmmakers and work with the natural scientist and virologist Dr. rer. nat. Stefan Lanka, who publicly questioned the scientific basis of the "Corona crisis" from the start. You will find all the important texts by Dr. Lanka on the subject of Corona

https://wissenschafftplus.de/cms/de/wichtige-texte 

Antibodies

The Misinterpretation of Antibodies

https://drive.google.com/file/d/1UWuCY1uJgMdkv9FCiA_HYOkKWHUKIQLt/view 

All Mike Stone Antibody studies

https://docs.google.com/document/d/e/2PACX-1vS5jTh_Jo-hTt7mbMhQRF57rClqbiKBTWGuLKRBhzPt2QD77SYpMIGzTLi9fMcJKw7Kxg5lrssdGcwD/pub

Reproducibility crisis: Blame it on the antibodies

https://viroliegy.com/2021/10/22/the-reproducibility-crisis-in-antibody-research 

MERRILL CHASE INADVERTENTLY DISPROVES ANTIBODIES IN 1942:

https://docs.google.com/document/d/e/2PACX-1vTAH850UMaXKRFBVIlng28qvCJIb6DqjbkZOEeHtSqHYn4f-udAX7nQx1IsWrNKFaBRJyE6u3D6cd8T/pub

FIRST ATOMIC RESOLUTION STRUCTURE OF AN ANTIBODY FRAGMENT(?) 1973:

https://docs.google.com/document/d/e/2PACX-1vTEitvFbNZYKclrIuToydCxHONdMxK9x_SgPqM-xQ6Wady5R5WRK3KoJNJa9YdZvajQb7KVJhz2j5WF/pub

KÖHLER AND MILSTEIN'S 1975 MONOCLONAL ANTIBODIES:

https://docs.google.com/document/d/e/2PACX-1vT8pekwplFhqcCA65eKUQLkmvhb8BKw7c1CltZOncGHPRj2vnbcwSLpHLKu0Pi-aelfYcIsBKuTbAwm/pub

ANTIBODY IMAGES(?):

https://docs.google.com/document/d/e/2PACX-1vSakKiCSr0b_7Kk35UUSy2GduDF9l3qQ-PyCSMjOMT_thSueSnUEN_gIVt0f_f1pzY3mSrvmXN3kPNw/pub

2011 TEM IMAGES OF ANTIBODIES(?):

https://docs.google.com/document/d/e/2PACX-1vQjtJIGaxef5vsmdLscy2FVs2IZF6cfZ8ohGfYV_GhbmioeSFjbqrM_0JvZB2qysc4Mo36O2xzkOU95/pub

“There is no such thing as providing immunity or antibodies against these so called assaults when it’s not about the matter, it’s about the environment around the matter” Dr Robert Young

https://mobile.twitter.com/FloydsArchives/status/1369293555110346753 

The Misinterpretation of Antibodies Stefan Lanka 7/12/20

https://truthseeker.se/wp-content/uploads/The-Misinterpretation-of-the-Antibodies.pdf 

https://truthseeker.se/wp-content/uploads/Stefan-Lanka-The-Misinterpretation-of-the-Antibodies-English-Translation.pdf 

Antibody testing

http://theinfectiousmyth.com/coronavirus/AntibodyTestingForCOVID.pdf

David Crowe’s brilliant new paper takes apart antibody testing 5/15/20

https://blog.nomorefakenews.com/2020/05/15/covid-david-crowes-brilliant-new-paper-takes-apart-antibody-testing/ 

Antibodies & Immunity: Dispelling Two More Myths 10/5/20

https://whatreallymakesyouill.com/antibodies-immunity-dispelling-two-more-myths 

Antibodies don’t equal immunity. Busting the antibody protection paradigm

https://thefreedomarticles.com/antibodies-dont-equal-immunity-antibody-protection-paradigm

Bedrock of vaccination theory crumbles as science reveals antibodies not necessary to fight viruses

http://whale.to/v/bedrock.html 

Antibody ruse and false science

http://www.whale.to/vaccines/antibody_ruse.html

Antibody Theory

http://whale.to/vaccines/antibody.html 

Here come the antibody tests—quick, easy, and insane

https://blog.nomorefakenews.com/2020/04/05/covid-here-come-the-antibody-tests-quick-easy-and-insane/ 

You may test positive for antibodies even if you have never had symptoms of COVID-19

https://www.cdc.gov/coronavirus/2019-ncov/testing/serology-overview.html

Antibody testing not to be used for diagnostic results to confirm virus per FDA

https://i.postimg.cc/ZqDvDnC1/anti-body-testing-not-to-be-used-for-diagnostic-results-per-fda.jpg

Antibody test shows positive if you had flu shot or common cold in the past

https://i.postimg.cc/G3PQ9NJx/Antibody-test-show-positive-if-you-had-flu-shot-or-common-cold.jpg 

Covid19: Italian Antibody Data

https://swprs.org/covid19-italian-antibody-data/

Anti-body theory

https://i.postimg.cc/1t8KDGVs/Anti-body-theory.jpg 

Kids Develop Coronavirus Antibodies Without Ever Testing Positive 11/19/20

https://www.sciencealert.com/everyone-in-this-family-has-coronavirus-antibodies-but-only-the-parents-had-covid-19 

Are antibodies a sign of protection/immunity from overcoming a "virus" or are they a sign that you are currently infected with a "virus?"

https://www.facebook.com/mike.stone.54/posts/10158013568638576 

There are over 70 conditions that can trigger a Positive HIV Antibody test.

https://m.facebook.com/story.php?story_fbid=10158013568638576&id=502548575

Experts say serology tests unreliable, as immunity doesn’t require antibodies 1/27/21

https://www.timesofisrael.com/experts-say-serology-tests-unreliable-as-immunity-doesnt-require-antibodies/amp/ 

DR. AMANDHA VOLLMER (COVID WORLD ORDERS + REFLECTIONS ON THE (FALSE) ANTIBODY THEORY) 2/25/21

https://lbry.tv/@FwapUK:1/DR.-AMANDHA-VOLLMER-(COVID-WORLD-ORDERS-+-REFLECTIONS-ON-THE-(FALSE)-ANTIBODY-THEORY):a 

"Antibody testing isn’t conclusive for predicting COVID-19 immunity

https://www.mdanderson.org/cancerwise/what-do-negative-positive-antibody-test-results-mean-after-a-covid-19-vaccine.h00-159459267.html 

Abstruse Antibody Test

https://truthseeker.se/wp-content/uploads/2021/04/Abstruse-Antibody-Test.pdf 

Test results from currently authorized SARS-CoV-2 antibody tests SHOULD NOT BE USED TO EVALUATE A PERSON’S LEVEL OF IMMUNITY OR PROTECTION FROM COVID-19

https://nateserg808.wixsite.com/my-site/post/antibody-2 

Transmission of SARS-CoV-2

To date, 26 studies on protective immunity have only been performed in animal models and 27 correlates of protection have not been established in humans

https://www.medrxiv.org/content/10.1101/2020.08.13.20173161v1.full.pdf 

Small droplet aerosols in poorly ventilated spaces and SARS-CoV-2 transmission

https://www.thelancet.com/journals/lanres/article/PIIS2213-2600(20)30245-9/fulltext

Aerosol and Surface Stability of SARS-CoV-2 as Compared with SARS-CoV-1

https://www.nejm.org/doi/pdf/10.1056/NEJMc2004973?articleTools=true

But this isn’t thought to be the main way the virus spreads.

https://www.cdc.gov/media/releases/2020/s0522-cdc-updates-covid-transmission.html

Despite extensive laboratory investigations in patients with respiratory tract infections, no microbiological cause can be identified in a significant proportion of patients.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC538593/ 

Aerosol and Surface Distribution of Severe Acute Respiratory Syndrome Coronavirus 2 in Hospital Wards, Wuhan, China, 2020

https://wwwnc.cdc.gov/eid/article/26/7/20-0885_article?deliveryName=USCDC_333-DM25707

Has SARS-CoV2 been isolated, purified and demonstrated to be the cause of COVID19?

https://www.researchgate.net/post/Has_SARS-CoV2_been_isolated_purified_and_demonstrated_to_be_the_cause_of_COVID19

SARS COV-2 Sequencing

https://i.postimg.cc/yxjG7nXh/SARS-COV-2.jpg 

Paper compares the accuracy of various COVID PCR test protocols recommended by the WHO. The E Charité [Drosten] and N2 US CDC assays were positive for all specimens, including negative samples and negative controls (water)." only CTs 40 and 45 got tested 12/6/20

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7355678/ 

Gaining immunity from propaganda from CDC 8/18/20

https://www.youtube.com/watch?v=CCJaQAr9wlM&feature=youtu.be

CDC Quietly Changes Testing Guidelines To Exclude People With No Symptoms 8/26/20

https://www.yahoo.com/huffpost/cdc-testing-guidelines-coronavirus-no-symptoms-141544368.html

Covid-19" and viremia go hand-in-hand. Yet they never screen for "SARS-COV-2" during blood transfusions nor do they regularly look for "infectious virus" by culturing from blood samples.

https://www.news-medical.net/amp/news/20200901/SARS-CoV-2-RNA-viremia-is-a-robust-marker-of-critical-illness-in-COVID-19.aspx 

Isolation and Growth Characteristics of SARS-CoV-2 in Vero Cell

https://www.virosin.org/article/doi/10.1007/s12250-020-00241-2

Study of nearly 2,000 Marine recruits reveals even under quarantine they tested positive for SARS-CoV-2 transmission

https://www.mountsinai.org/about/newsroom/2020/study-of-nearly-2000-marine-recruits-reveals-asymptomatic-sarscov2-transmission-among-young-adults-during-supervised-quarantine-pr 

All-cause mortality is not statistically larger than usual. Therefore SARS-CoV-2 is not an unusually virulent viral respiratory disease pathogen. 11/17/20

https://www.researchgate.net/publication/343775235_Evaluation_of_the_virulence_of_SARS-CoV-2_in_France_from_all-cause_mortality_1946-2020 

Without travel, you’re left with everyone who has a common cold or the flu, or a variety of other maladies that show up with coughing, shortness of breath, and low-grade fever." 11/23/20

https://www.reliasmedia.com/articles/22464-sars-vs-flu-can-you-tell-serious-disease-from-common-malady 

We located the "target sequence", a fragment of 108 nucleotides located between positions 12,690 & 12,797 of the "genome", which is this one: ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG.

https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?report=genbank&to=29903 

It literally says on page 5: "Whenever possible, suspected active infection should be tested with a nucleic acid amplification test (NAAT) such as RT-PCR. NAAT tests should target the SARS-CoV-2 genome but since there is no known global circulation of SARS-CoV-1 a Sarbecovirus sequence (presumed to include at least five human and animal coronaviruses including SARS-CoV-1 and SARS-Cov-2) is also a reasonable target" 11/25/20

https://apps.who.int/iris/rest/bitstreams/1302661/retrieve 

The scam is conformed, PCR does not detect SarsCov2 11/25/20

https://www.dsalud.com/reportaje/la-estafa-se-constata-la-pcr-no-detecta-el-sars-cov-2/ 

http://philosophers-stone.info/wp-content/uploads/2020/11/The-scam-has-been-confirmed-Dsalud-November-2020.pdf 

How does SARS-CoV-2 cause COVID-19? A substantial proportion of SARS-CoV-2–infected individuals report few, if any, symptoms and recover completely

https://science.sciencemag.org/content/369/6503/510.full 

Attempts at virus isolation from human patients were generally unsuccessful 12/6/20

https://www.nature.com/articles/s41564-020-00835-2 

Can SARS-CoV-2, the Virus that Causes COVID-19 Disease, Be Spread by Blood?

https://tools.niehs.nih.gov/wetp/public/hasl_get_blob.cfm?ID=11981

https://m.facebook.com/groups/1989276261371369?view=permalink&id=2067036960261965&anchor_composer=false 

These results are consistent with previous susceptibility findings for SARS-CoV(15). In addition, SARS-CoV-2 FAILED TO REPLICATE in the bat EFK3B cells which are susceptible to MERS-CoV. 12/6/20

https://www.biorxiv.org/content/10.1101/2020.03.02.972935v1.full.pdf 

The epidemiological investigation was implemented based on personal interviews and data collection on closed-circuit television images, and cell phone location data. 12/10/20

https://jkms.org/DOIx.php 

So how can they know that those particles from the cell cultures (petri dish / line tube) are' virus'? Why misinterpretation of electron micrographs in SARS-CoV-2-infected tissue goes viral

https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)32079-1/fulltext 

Scripture 

Luke 38-41 But the Pharisee was surprised when he noticed that Jesus did not first wash before the meal. Then the Lord said to him, “Now then, you Pharisees clean the outside of the cup and dish, but inside you are full of greed and wickedness. You foolish people! Did not the one who made the outside make the inside also? But now as for what is inside you—be generous to the poor, and everything will be clean for you.

Studies that tried to prove you could catch a “disease” but they all failed

Studies that tried to prove you could catch a “disease” but they all failed All in one document

https://docs.google.com/document/d/e/2PACX-1vRaz6zMcClvSdZuc20O4AOwHSAwri_sZ8UqT0yswgTZZA7LDRnJTcVB3smmk-FEymUjIc2oqvdw9gt5/pub

Contagion a Fairy Story

https://northerntracey213875959.wordpress.com/2021/02/22/contagion-a-fairy-story 

MORRISONS SUPERMARKET COVID SIMULATION EVENT

https://crazzfiles.com/morrisons-supermarket-covid-simulation-event-2/ 

Experiments that failed to show virus contagion

https://i.postimg.cc/RhyDkMCw/Experiments-that-failed-to-show-virus-contagion.jpg 

https://i.postimg.cc/nz5GRCmB/Experiments-which-failed-to-prove-contagion.jpg 

https://jamanetwork.com/journals/jama/article-abstract/219497 

Experiments with measles that failed to show contagion

https://i.postimg.cc/cL7kvLNc/measles.jpg 

Scientists Proved Viruses Are Not Contagious in 1918

https://www.thebernician.net/scientists-proved-viruses-are-not-contagious-in-1918/

A study on infectivity of asymptomatic SARS-CoV-2 carriers

https://pubmed.ncbi.nlm.nih.gov/32405162/

Some interesting yet unsuccessful attempts to spread influenza

https://www.sciencedaily.com/releases/2015/04/150430170750.htm 

Does Influenza Transmission Occur from Asymptomatic Infection or Prior to Symptom Onset?

https://journals.sagepub.com/doi/abs/10.1177/003335490912400205 

Cases with mild symptoms & no fever can’t spread infection

https://timesofindia.indiatimes.com/india/cases-with-mild-symptoms-no-fever-cant-spread-infection-government/articleshow/75857656.cms 

EXPERIMENTS TO DETERMINE MODE OF SPREAD OF INFLUENZA

https://jamanetwork.com/journals/jama/article-abstract/221687 

Dr Rosenau experiments to determine mode of spread of influenza

https://sci-hub.se/https://jamanetwork.com/journals/jama/article-abstract/221687

Experiments Upon Volunteers to Determine the Cause and Mode of Spread of Influenza, Boston, November and December, 1918

https://quod.lib.umich.edu/f/flu/3750flu.0016.573

Although these experiments are too few in number to be conclusive, they indicate that the causative agent of swine influenza is not a filtrable virus.

https://core.ac.uk/download/pdf/7832816.pdf 

https://core.ac.uk/search?q=Although%20these%20experiments%20are%20too%20few%20in%20number%20to%20be%20conclusive,%20they%20indicate%20that%20the%20causative%20agent%20of%20swine%20influenza%20is%20not%20a%20filtrable%20virus.

Canada influenza studies in the 1920’s

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1524149/pdf/canmedaj00406-0019.pdf 

A review of the literature on influenza and the common cold / by J. G. Townsend, surgeon, United States Public Health Service

https://catalog.hathitrust.org/Record/102609951 

WHO: No Asymptomatic Transmission, April, 2020 

https://revealingfraud.com/2020/05/health/who-no-asymptomatic-transmission-april-2020/ 

WHO Says It's 'Rare' for Asymptomatic Covid-19 Patients to Infect Others

https://lbry.tv/@HumanRights:4/WHO-Says-It's-'Rare'-for-Asymptomatic-Covid-19-Patients-to-Infect-Others:7

National Institute of Health US 1921

https://play.google.com/store/books/details?id=wC1DAAAAYAAJ 

Salicylates and Pandemic Influenza Mortality, 1918–1919 Pharmacology, Pathology, and Historic Evidence

https://academic.oup.com/cid/article/49/9/1405/301441 

150 U.S. Public Health Service Experiments from 1919 prove that disease is not transmittable

https://www.youtube.com/watch?v=khec-jvZx9E&feature=youtu.be 

Dr. Matthew J. Rodermund, MD offered $10k to anyone who could prove scientifically that smallpox is contagious. Nobody ever claimed the money.

http://www.whale.to/vaccines/smallpox8.html 

Experiments to Determine Mode of Spread of Influenza Milton J Rosenau

https://zenodo.org/record/1505669

1918 deer island flu survivors at a naval prison

https://www.coursehero.com/file/prfu1q/1918-Deer-Island-Flu-Survivors-At-a-naval-prison-on-Deer-Island-Boston-Harbor/

Dr Robert Willner injects himself with HIV

https://www.youtube.com/watch?v=tQCKb1JV-4A

Germs are powerless to cause disease

https://www.rawfoodexplained.com/contagion-epidemics/germs-are-powerless-to-cause-disease.html 

On the epidemiology of influenza

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2279112 

The State of Science, Microbiology, and Vaccines Circa 1918

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2862332/ 

Dr. Rodermunds experiment smallpox

https://i.postimg.cc/FHvH0S0n/smallpox.jpg 

Experiments at Gallops Island

https://i.postimg.cc/cCWw3B2G/gallopsisland.jpg 

Dr Rodermund spreads smallpox on his skin doesn’t get infected

https://i.postimg.cc/8cbWmrgJ/smallpox1.jpg 

US Govt tried to infect 100 Navy men with the flu but 100% did not get infected.

https://i.postimg.cc/5y1QnC7f/1918flu.jpg

1918 Goat Island contagion experiment

https://i.postimg.cc/zDHcPqx0/Goat-Island-Contagion-Experiment.jpg 

The experiments made at Goat Island by Navy doctors

https://sentinel.christianscience.com/issues/1919/4/21-32/the-experiments-made-at-goat-island-by-navy-doctors 

How did Christian Scientists respond to the 1918–1919 Spanish flu?

https://www.marybakereddylibrary.org/research/how-did-christian-scientists-respond-to-the-1918-1919-flu-epidemic/ 

Failed attempts to prove scarlet fever contagious

https://i.postimg.cc/FKFqHV9j/Failed-scarlet-fever-contagion.jpg 

The failures to inoculate man form impressive evidence that it is not the primary infecting agent. The failure of animal inoculation and the absence of a pandemic strain are further facts in support of this view.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1524149/ 

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1524149/pdf/canmedaj00406-0019.pdf 

Pulmonary tuberculosis transmission and its etiology and treatment:

https://books.google.com/books?id=Xw41AQAAMAAJ&pg=PA57&source=gbs_toc_r&cad=4#v=onepage&q&f=false 

Perhaps the most interesting epidemiological studies conducted during the 1918–1919 pandemic were the human experiments conducted by the Public Health Service and the U.S. Navy under the supervision of Milton Rosenau on Gallops Island, the quarantine station in Boston Harbor, and on Angel Island, its counterpart in San Francisco. The experiment began with 100 volunteers from the Navy who had no history of influenza. Rosenau was the first to report on the experiments conducted at Gallops Island in November and December 1918. His first volunteers received first one strain and then several strains of Pfeiffer’s bacillus by spray and swab into their noses and throats and then into their eyes. When that procedure failed to produce disease, others were inoculated with mixtures of other organisms isolated from the throats and noses of influenza patients. Next, some volunteers received injections of blood from influenza patients. Finally, 13 of the volunteers were taken into an influenza ward and exposed to 10 influenza patients each. Each volunteer was to shake hands with each patient, to talk with him at close range, and to permit him to cough directly into his face. NONE of the volunteers in these experiments developed influenza.  Rosenau was clearly puzzled, and he cautioned against drawing conclusions from negative results. He ended his article in JAMA with a telling acknowledgement: “We entered the outbreak with a notion that we knew the cause of the disease and were quite sure we knew how it was transmitted from person to person. Perhaps, IF WE HAVE LEARNED ANYTHING, IT IS THAT WE ARE NOT QUITE SURE WHAT WE KNOW ABOUT THE DISEASE. The research conducted at Angel Island and that continued in early 1919 in Boston broadened this research by inoculating with the Mathers streptococcus and by including a search for filter-passing agents, but it produced similar negative results. The failures to inoculate man form impressive evidence that it is not the primary infecting agent. The failure of animal inoculation and the absence of a pandemic strain are further facts in support of this view. It seemed that what was thought to be supposedly one of the most contagious of communicable DISEASES COULD NOT BE TRANSFERRED under ANY experimental conditions. This caused the American Public Health Association (APHA) at that time to declare that since the cause of the flu was unknown, there was no logical basis for a vaccine to prevent the disease. In March of 1919 Rosenau & Keegan conducted 9 separate experiments in a group of 49 healthy men, to prove contagion. In all 9 experiments, 0/49 men became sick after being exposed to sick people or the bodily fluids of sick people.

https://jamanetwork.com/journals/jama/article-abstract/221687

In November 1919, 8 separate experiments were conducted by Rosenau et al. in a group of 62 men trying to prove that influenza is contagious and causes disease. In all 8 experiments, 0/62 men became sick. Another set of 8 experiments were undertaken in December of 1919 by McCoy et al. in 50 men to try and prove contagion. Once again, all 8 experiments failed to prove people with influenza, or their bodily fluids cause illness. 0/50 men became sick. In 1919, Wahl et al. conducted 3 separate experiments to infect 6 healthy men with influenza by exposing them to mucous secretions and lung tissue from sick people. 0/6 men contracted influenza in any of the three studies.

https://www.jstor.org/stable/30082102?seq=1#metadata_info_tab_contents

In 1920, Schmidt et al conducted two controlled experiments, exposing healthy people to the bodily fluids of sick people. Of 196 people exposed to the mucous secretions of sick people, 21 (10.7%) developed colds and three developed grippe (1.5%). In the second group, of the 84 healthy people exposed to mucous secretions of sick people, five developed grippe (5.9%) and four colds (4.7%). Of forty-three controls who had been inoculated with sterile physiological salt solutions eight (18.6%) developed colds. A higher percentage of people got sick after being exposed to saline compared to those being exposed to the “virus”.

https://pubmed.ncbi.nlm.nih.gov/19869857/ https://catalog.hathitrust.org/Record/102609951

In 1921, Williams et al. tried to experimentally infect 45 healthy men with the common cold and influenza, by exposing them to mucous secretions from sick people. 0/45 became ill.

https://pubmed.ncbi.nlm.nih.gov/19869857/

In 1924, Robertson & Groves exposed 100 healthy individuals to the bodily secretions from 16 different people suffering from influenza. The authors concluded that 0/100 became sick as a result of being exposed to the bodily secretions.

https://academic.oup.com/jid/article-abstract/34/4/400/832936?redirectedFrom=fulltextA

In 1930, Dochez et al. attempted to infect a group of men experimentally with the common cold. The authors stated in their results, something that is nothing short of amazing. “It was apparent very early that this individual was more or less unreliable and from the start it was possible to keep him in the dark regarding our procedure. He had inconspicuous symptoms after his test injection of sterile broth and no more striking results from the cold filtrate, until an assistant, on the second day after injection, inadvertently referred to this failure to contract a cold. That evening and night the subject reported severe symptomatology, including sneezing, cough, sore throat and stuffiness in the nose. The next morning he was told that he had been misinformed in regard to the nature of the filtrate and his symptoms subsided within the hour. It is important to note that there was an entire absence of objective pathological changes”.

https://pubmed.ncbi.nlm.nih.gov/19869798/

In 1937 Burnet & Lush conducted an experiment exposing 200 healthy people to bodily secretions from people infected with influenza. 0/200 became sick.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2065253/

Swine flu?…McBryde, Niles, and Moskey (1) made five attempts to pass the etiological agent of swine influenza through small Berkefeld or Mandler filters but were unable to reproduce the disease by dropping such filtrates into the nostrils of normal hogs. In two of these experiments, unfiltered material failed to produce the disease in their control animals. “Although these experiments are too few in number to be conclusive, they indicate that the CAUSATIVE AGENT of swine influenza is NOT a filtrable ‘VIRUS.’’

https://pdfslide.net/documents/swine-influenza-iii-filtration-experiments-and-etiology.html

Smallpox?. Dr. Rodermund, a physician in the state of Wisconsin, created a sensation by smearing his body with the exudate of smallpox sores in order to demonstrate to his medical colleagues that a healthy body could not be infected with the disease.  He was arrested and quarantined in jail, but not before he had come into contact with many people. Not a single case of smallpox developed through this ‘exposure’’....”I have ...handled intimately thousands of cases of contagious diseases, and I do not remember a single instance where any of us was the least affected by such contact Dr. Charles A.A. Campbell, MD of San Antonio, USA, who was for years in charge of an isolation hospital, made exhaustive experiments in order to demonstrate that smallpox is contagious, but found that this is not the case.

http://www.whale.to/a/rodermund.html

SARS Cov1? ALTHOUGH ONE CAN SPECULATE ABOUT THE POSSIBLE ROLES OF BOTH CORONAVIRUSES AND HUMAN METAPNEUMOVIRUS IN SARS, It is CURRENTLY NOT CLEAR WHAT ROLE, IF ANY, EITHER OF THESE VIRUSES HAS IN CAUSING SARS. FURTHER COLLABORATIVE INVESTIGATIONS ARE NEEDED.`` "THE MECHANISM OF TRANSMISSION OF THE AGENT OR AGENTS CAUSING SARS IS NOT YET UNDERSTOOD." "We WERE NOT, HOWEVER, ABLE TO DEMONSTRATE CORONAVIRUS ANTIGENS IN PATIENT TISSUES BY HISTOLOGIC AND IMMUNOHISTOCHEMICAL METHODS OR TO DEMONSTRATE A DIRECT INVOLVEMENT IN THE PATHOLOGIC PROCESS. NEITHER WERE WE ABLE TO DEMONSTRATE SARS-ASSOCIATED CORONAVIRUS INFECTION IN ALL SUSPECTED PATIENTS WITH SARS."

https://www.nejm.org/doi/10.1056/NEJMoa030781

The evidence SUGGESTS. There is no direct evidence of human-to-human transmission of "SARS-COV-2" from respiratory transmission. Everything that has come out is indirect evidence.  DIRECT EVIDENCE is defined as evidence THAT DIRECTLY PROVES A KEY FACT AT ISSUE.  INDIRECT EVIDENCE, also referred to as circumstantial evidence, is evidence that relies on an INFERENCE to connect it to a conclusion. There is NO DIRECT EVIDENCE of human-to-human transmission of "SARS-COV-2." It is all INDIRECT EVIDENCE from which assumptions, hypotheses, and theories are drawn from and sold as conclusive.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7505025 

"The ASSOCIATION between 2019-nCoV and the disease HAS NOT BEEN VERIFIED BY ANIMAL EXPERIMENTS TO FULFIL THE KOCH’S POSTULATES TO ESTABLISH A CAUSATIVE RELATIONSHIP BETWEEN A MICROORGANISM AND A DISEASE." 2/24/21

https://www.nature.com/articles/s41586-020-2012-7

Google Books on Human experiments prior to WWII

The Starry Cross details Spanish Flu

https://books.google.com/books?id=HCkyAQAAMAAJ&pg=RA1-PA59&lpg=RA1-PA59&dq=dr+rodermund+human+experiments&source=bl&ots=UN_KPCOAFC&sig=ACfU3U0w64K1QDB-FRdGLAR_aStyb5bUwg&hl=en&sa=X&ved=2ahUKEwihiP3x6MPpAhVTmXIEHaZgCb8Q6AEwCXoECAUQAQ#v=onepage&q=dr%20rodermund%20human%20experiments&f=false 

Subjected to Science: Human Experimentation in America Before the Second World War

https://books.google.com/books/about/Subjected_to_Science.html?id=6F2lmCfiy8gC 

Journal of Medicine and Science 1899

https://books.google.com/books?id=RBugAAAAMAAJ&pg=RA1-PA19&source=gbs_selected_pages&cad=3#v=onepage&q&f=false 

The Journal of the American Medical Association

https://books.google.com/books/about/The_Journal_of_the_American_Medical_Asso.html?id=HvZGAQAAMAAJ 

Dr. Rodermund - smallpox

"Dr Rodermund, a physician in the state of Wisconsin, created a sensation by smearing his body with the exudate of smallpox sores in order to demonstrate to his medical colleagues that a healthy body could not be infected with the disease.  He was arrested and quarantined in jail, but not before he had come into contact with many people.  Not a single case of smallpox developed through this "exposure"....I have ...handled intimately thousands of cases of contagious diseases, and I do not remember a single instance where any of us was the least affected by such contact."

http://www.whale.to/a/rodermund.html

"For years Dr. Matthew J. Rodermund, MD of Wisconsin, USA, offered $10,000 to anyone who could prove scientifically that smallpox is contagious. Nobody ever claimed the money.  Dr Charles A.A. Campbell, MD of San Antonio, USA, who was for years in charge of an isolation hospital made exhaustive experiments in order to demonstrate that smallpox is contagious, but found that this is not the case."

http://www.whale.to/vaccines/infectiousness_smallpox_q.html

Dr. Rodermund experiment with smallpox

https://i.postimg.cc/FHvH0S0n/smallpox.jpg

Dr. Rodermund quote on Gods Law

https://i.postimg.cc/1R2rxvFk/Dr-Rodermund-quote.jpg 

Smallpox: Dispelling A Popular Myth

https://whatreallymakesyouill.com/smallpox-dispelling-a-popular-myth 

Personally, I have not only come into direct contact with smallpox patients many times, but have taken off and rubbed my outer clothes on the beds of the patients and then returned to the city and mingled freely with my family, friends, and patients, without disinfecting at all.

http://www.whale.to/a/campbell1.html 

LACK OF KNOWLEDGE ON "VIRAL" MODES OF TRANSMISSION:

https://docs.google.com/document/d/e/2PACX-1vSmTmG9VehA_XMea2ctjZW3f_yw4ZIL74pWpznt7eV-qpGyXmOHMlMMEBQITeCBcgSeXa5GAzalbwo_/pub 

Jenner and the Speckled Monster: The True History of Smallpox

https://www.newbraveworld.org/smallpox/ 

How We Know That Monkeypox Is Another Scam (Just Like Covid) 6/16/22

https://www.newbraveworld.org/monkeypox-scam 

All contagion studies

https://docs.google.com/document/d/e/2PACX-1vTUCzRplo8fGKIfn-RVkFch5hOsWJhj56xCy1JlXxXSV86ezpTmKKns7umS6_VWwFz8-dde5GqfYAC5/pub 

Scripture

Do Not Fear

Matthew 10:26 “So have no fear of them, for nothing is covered that will not be revealed, or hidden that will not be known."

Isaiah 41:10 "Fear not, for I am with you; be not dismayed, for I am your God; I will strengthen you, I will help you, I will uphold you with my righteous right hand."

Isaiah 35:3-4 Strengthen the feeble hands, steady the knees that give way; say to those with fearful hearts, “Be strong, do not fear; your God will come, he will come with vengeance; with divine retribution he will come to save you.”

Hebrews 13:6 "So we can confidently say, 'The Lord is my helper; I will not fear; what can man do to me?'”

Fear

All fear is the disease links in document

https://docs.google.com/document/d/e/2PACX-1vRFVAxc6-oUbsfkQKqt3uSQre91LVJUALpRPeRA4F5oqtKI7MoydAVNG4O3SUz8tktK3KcZuK69IYyG/pub 

Fear is the Real "Virus" The power of the mind to influence our health and well-being was an often overlooked aspect of a "pandemic" which effectively used our emotions as a weapon against us.

https://mikestone.substack.com/p/fear-is-the-real-virus 

Scared into submission by the Government's campaign of fear 7/5/21

https://www.bournbrookmag.com/home/scared-into-submission-by-the-governments-campaign-of-fear 

We Have the Power to Refuse the Fear 11/15/20

https://tessa.substack.com/p/we-have-the-power-to-refuse-the-fear 

Negative information which is spread through mass media repetitively can affect public health negatively in the form of nocebo effects and mass hysteria.

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7913136/ 

The intention behind the information is not in the first place ‘predicting the future’, but instilling fear. Fearful people are vulnerable. 10/20/20

https://www.globalresearch.ca/great-reset-revisited/5723573 

How Fear Can Kill You

https://gizmodo.com/how-fear-can-kill-you-1829936146

How fear makes us sick

https://lissarankin.com/how-fear-makes-you-sick/

Nosobia - Fear of disease and symptoms associated

https://beatyourfears.com/specific-fears/fear-of-disease/

The Nocebo Effect: Negative Thoughts Can Harm Your Health

https://www.psychologytoday.com/us/blog/owning-pink/201308/the-nocebo-effect-negative-thoughts-can-harm-your-health 

Americans Are Suffering From ‘Mass Delusional Psychosis’ Because Of Covid-19 3/16/21

https://www.eviemagazine.com/post/americans-are-suffering-from-mass-delusional-psychosis-because-of-covid-19 

Wearing a mask. We found that inhaled CO2 reduced brain pH and evoked fear behavior in mice. 9/1/20

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2808123/ 

How fear causes sickness

https://fmidr.com/fear-causes-sickness/

The Effects of Chronic Fear on a Person's Health

https://www.ajmc.com/conferences/nei-2017/the-effects-of-chronic-fear-on-a-persons-health

How Government Sells Fear and Sickness: The Case of the Flu  

https://www.aier.org/article/how-government-sells-fear-and-sickness-the-case-of-the-flu/

The consequences of fear

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1299209/

The fear of Corona-virus is more dangerous than the disease

https://dailytimes.com.pk/629465/the-fear-of-corona-virus-is-more-dangerous-than-the-disease/ 

Professor Dr. Stefan Hockertz: Not the virus, but the fear of it makes you sick

https://lasno.de/professor-dr-stefan-hockertz-nicht-das-virus-sondern-die-angst-davor-macht-krank/ 

Multiple symptom search combinations for fear

https://www.rightdiagnosis.com/symptoms/fear/symptom-search.htm 

Nothing spreads like Fear  

https://i.postimg.cc/CLJ0Bp6N/Nothing-spreads-like-fear.jpg 

THE VIRAL (INFECTIOUS DISEASE AND EPIDEMIC) FEAR RACKET

http://whale.to/a/infectious_scares.html

The Current Health Scenario.: Corona Times: Fear is being unnecessarily induced

https://currenthealthscenario.blogspot.com/2020/08/corona-times-fear-is-being.html

Professor Karol Sikora: fear is more deadly than the virus

https://altcensored.com/watch?v=uk2YZfnsOPg

“Stigma, to be honest, is more dangerous than the virus itself. Fear and panic are dangerous,

https://www.breitbart.com/health/2020/03/03/world-health-organization-fear-and-panic-over-coronavirus-dangerous-calm-down/ 

Fear appeals persuasion

http://socialpsychonline.com/2016/08/fear-appeals-persuasion-psychology/ 

Fear The Coronavirus Pandemic’s Needless Deaths  

https://www.nytimes.com/2020/06/09/opinion/coronavirus-hospitals-deaths.html

This war is being fought with one single weapon, fear. 10/13/20

https://oye.news/news/government/this-is-a-war-the-weapon-is-fear-and-their-enemy-is-you/ 

Fear is how they control you, not reason or science. 11/30/20

https://mobile.twitter.com/critica18495985/status/1332754103454281729?prefetchtimestamp=1606610857442 

The Security Junkie Syndrome; How Pausing the World Leads to Catastrophe | David Eberhard | TEDxSSE 5/24/21

https://www.youtube.com/watch?v=43J7hD9I0jY 

Fear Is The Sickness Dr. Kelly Brogan

https://kellybroganmd.com/fear-is-the-sickness/ 

A Message to Help Dispel Fear Dr. Kelly Brogan

https://kellybroganmd.com/message-to-dispel-fear 

Collectivists respond to fear with a desperate need to micromanage their environment; they believe that if they can dictate people and events to a certain degree, they can eliminate unexpected outcomes and be free of fear

https://www.sott.net/article/456853-Why-Do-Some-People-Support-Tyranny-While-Others-Defy-It 

Why an Obsession with Safety creates Sick Minds and a Sick Society

https://www.youtube.com/watch?v=e3EsCIjvrSw 

Dr Jordan Grant

Questioning Authority: Education & Science - More Misplaced Trust 3/1/22

https://odysee.com/@dawnofpeace:5/education_and_science_more_misplaced_trust:1 

A LIGHT ON - #27: THE CONTAGION MYTH WITH DR. JORDAN GRANT, DANIEL ROYTAS, & SOPHIA BARALDI 5/15/22

https://odysee.com/@ALightOn:8/CONTAGION:b3

A presentation by Jacob Diaz, Mike Donio, Dr. Jordan Grant, Mike Stone and Alec Zeck addressing the fallacious reasoning, misinterpretations, and pseudoscience of virology 7/21/22

https://www.bitchute.com/video/Z6chB1QtMFXh

JORDAN GRANT + SOPHIA BARALDI - THE SCIENTIFIC METHOD, LOGICAL FALLACIES, FICTITIOUS VIRUSES 1/31/22

https://www.bitchute.com/video/DPopT6vZIOv0 

In this episode, Alec Zeck has a discussion with Mike Donio, Jacob Diaz, Dr. Jordan Grant MD, and John Blaid on the fallacious reasoning, unproven assumptions, and lack of proof for virus theory. 2/25/22

https://www.bitchute.com/video/IWyynvrdRGUH 

The Pandemic of Fear - Doctors Round Table - Dr. Christiane Northrup MD, Dr. Jordan Grant MD and Dr. Catherine Fyans MD 3/12/21

https://www.humanley.com/blog/episode24 

Science is about proving X causes Y

https://i.postimg.cc/RhQwcvhf/CDC-cannot-provide-proof-of-isolated-Covid-Sars-Cov2.jpg 

Dr Jordan Grant on isolates

https://i.postimg.cc/W30YPtKv/Dr-Jordan-Grant-on-isolates.jpg 

If no virus was isolated why if I google that info does it show me studies that claim isolated?

https://i.postimg.cc/nhF8XkY5/No-isolates.jpg 

Learn the science and the scientific method

https://www.facebook.com/bob.incognitto.35/videos/131249482250074 

One scientific fallacy

https://i.postimg.cc/C1VTCzyJ/fallacy.jpg 

Dr Jordan Grant on Shedding

https://i.postimg.cc/J7xLp6X9/Dr-Jordan-Grant-on-Shedding.jpg 

Affirming the Consequent

https://criticalthinkeracademy.com/courses/76407/lectures/1106135 

Q&A Livestream with Dr Jordan Grant and Gil T hosted by dr Steven Devos 6/5/21

https://www.youtube.com/watch?v=iTK-eO2MW1E 

Michio Kaku on science

https://m.facebook.com/story.php?story_fbid=10102063929211555&id=44402780 

The Nature of Science and the Scientific Method Teacher Ed

https://docs.google.com/document/d/e/2PACX-1vRBxp61CcbDFdRkmAlXEVJ4RmWegA5iHJ_9wX3cVFkx9dg4XwVOOYjZ-kuDkda67Xb6S1UbM8STvKR-/pub

Episode 48: Daniel Roytas and Dr. Jordan Grant - Scientific Dogma Dr. Jordan Grant obtained his medical degree from the Texas Tech University School of Medicine and has undertaken specialist training in urology. Since the beginning of the pandemic, Dr. Grant has been asking some important questions in relation to the validity of the "science" underpinning various fields of medicine. In this podcast, Dr. Grant and I talk about what science really is, the scientific method, scientific dogma, germ theory, terrain theory, what causes UTIs, how antibiotics work and much more. 4/6/22

https://www.humanley.com/blog/episode48

With Dr. Grant being on the cutting edge of the most current research. Closing out Men’s Health Month, we dive deep into why it is ridiculous to worry about blood estrogen levels in men, what is the most intelligent approach to aging as a man, and the right questions one should ask if confronted with something like prostate cancer. 7/1/22

https://alidoiswin.com/episodes/the-truth-about-trt-it-s-relationship-to-prostate-cancer-estrogen-in-men-the-current-state-of-men-s-health-with

Dr. Stefano Scoglio, B.Sc, Ph.D. 2018 Candidate Nobel Prize in Medicine

The exposition of Dr. Scoglio's thesis on the Covid vaccines being unable to produce any spike protein, and being toxic in themselves, due to their synthetic mRNA and synthetic lipids content. 11/7/22

https://rumble.com/v1ru4yo-interview-with-stefano-scoglio-by-torsten-engelbrecht.html

The invented pandemic, the new pathology of Asymptomaticity, and the invalidity of the Test for Covid-19 - Dr. STEFANO SCOGLIO

http://igienenaturaleortopatia.altervista.org/blog/coronavirus/la-pandemia-inventata-la-nuova-patologia-dellasintomaticita-e-la-non-validita-del-test-per-il-covid-19-dr-stefano-scoglio/ 

Against the gatekeepers. 12/9/21

https://www.poliphylia.com/contro-i-gatekeepers-piccolo-documento-cattivo/ 

So, how do you isolate one specific virus from this huge blend of billions of indistinguishable particles, which includes beneficial exosomes?

https://beardedheretic.com/2020/10/17/the-invented-pandemic-the-lack-of-virus-isolation-and-the-invalid-covid-19-test/ 

https://jdfor2020.com/2020/11/the-invented-pandemic-the-lack-of-virus-isolation-and-the-invalid-covid-19-test/ 

Debunking Virology with Dr. Stefan Scoglio and Dr. Tom Cowan A discussion on the lack of evidence for SARS-Cov-2 and other viruses.3/3/21

https://odysee.com/@DrAndrewKaufman:f/Stefano---Tom-2-25-21:8 

PCR TEST - THE DOMINOES ARE FALLING 1/6/21

https://www.bitchute.com/video/aRA23j7OedFZ 

The Rapid Fruit Swab Experiment - A Response To Criticism From Pandemists 1/7/21

https://www.databaseitalia.it/lesperimento-tamponi-rapidi-sulla-frutta-una-riposta-alle-critiche-dei-pandemisti/

ITALY: “Scientists use lateral flow antigen rapid “SARSCoV2 test” on a kiwi fruit. The kiwi fruit is positive.

https://unshackledminds.com/kiwi-fruit-tests-positive-for-coronavirus/ 

Covid, Scoglio: The issue of virus isolation and its pathogenicity according to Koch's law of five postulates

https://agenparl.eu/covid-scoglio-candidato-nobel-medicina-2018-la-questione-dellisolamento-del-virus-e-della-sua-patogenicita-secondo-la-legge-dei-cinque-postulati-di-koch 

Covid Test: The WHO Also Gives Me (Us) Reason And The Novelty Of Rapid Antigen Tests

https://www.databaseitalia.it/test-covid-anche-loms-mi-ci-da-ragione-e-la-novita-dei-test-antigenici-rapidi 

Finally some honest and courageous scientist takes note of the serious flaws in the PCR approach of this pseudo-pandemic, as highlighted in the request for withdrawal of the article by Corman-Drosten (which gave birth in a scientifically perverse way to the first and most important molecular swab Covid, made up by a team of 22 scientists of international standing, including myself and Dr. Fabio Franchi representing Italy.

https://www.databaseitalia.it/onore-al-prof-thomas-aigner 

The experiment organized by Dr Friends and myself that definitively proves the absolute unreliability of the tests to dope of a dope virus 12/23/20

https://www.youtube.com/watch?v=Gmmz_YfxXTE&feature=share 

The invented pandemic Dr. STEFANO SCOGLIO

https://docs.google.com/document/d/e/2PACX-1vTljkFC84rBf6mook9Xed5EwYQ_wKGHKaV1sUF3LQQw1J-SrmIwedt3XMdDpELrkrgysJKnhybkPpSV/pub

As required by the Freedom of Information Act, the Irish health system has had to admit that it has no trace of COVID-19 isolated in the laboratory 1/13/21

https://rumble.com/vcmmsk-la-sanit-irlandese-ammette-il-virus-covid-19-non-stato-isolato.html 

STEFANO SCOGLIO: Woe to that science that becomes a religion 1/13/21 auto translate to english

https://www.youtube.com/watch?v=FkFyIiwMZwY 

Interview with Nobel Prize nominee in the field of medicine dr. S. Scoglio, spoken by dr. A. Blažėnienė 2/3/21

https://www.dailymotion.com/video/x7y2v4m 

https://www.ekspertai.eu/interviu-su-nobelio-premijos-nominantu-medicinos-srityje-drsscogliokuri-kalbina-drablazeniene/ 

Interview with Guido Gheri here... it's a bit long, but very comprehensive about the whole situation and current, including variations, vaccines, etc. 3/3/21

https://www.facebook.com/gheriguido54/videos/434519304659734 

MeWe link

https://mewe.com/i/stefanoscoglio1 

The first legal action begins with the related complaint, brought by 4 scientists and a lawyer. PCR Test is Fraudulent.

http://philosophers-stone.info/2020/11/25/the-first-legal-action-begins-with-the-related-complaint-brought-by-4-scientists-and-a-lawyer-pcr-test-is-fraudulent/ 

Dr. Saeed Qureshi

Dr. Saeed Qureshi is a retired Research Scientist from Health Canada, he has over 30 years of experience. His specialty is pharmacological safety, efficacy, and standards. Dr. Saeed Qureshi puts the facts all together to show there is no novel "virus"

https://docs.google.com/document/u/1/d/e/2PACX-1vRiCH1lUSnxieSSrkGBJuVEhJ3AwCNx8nU61DFh4YpNC3OnyU1i-lSFvOTKXWhNF75nNlSHS0ijXrYr/pub 

Drug Dissolution Testing website

http://www.drug-dissolution-testing.com/

https://www.researchgate.net/profile/Saeed-Qureshi 

“Perhaps the absurdity of the whole situation is that no one isolated and identified the virus (the poked-material), but a test was developed to measure the unknown virus. Only physicians or virologists can pull such a trick. In reality, developing tests fall under analytical chemistry science; however, the job was never assigned to it but kept within the medicine area. If chemistry scientists and laboratories had assigned the task of isolating the virus and developing its test, the pandemic would never have existed from day one. Scientifically, it is impossible to develop and validate a test without having the reference material in hand - isolated VlRUS, i.e., no VlRUS specimen, no valid test, no pandemic. Therefore, the declaration of the VlRUS and its disease certainly reflect ignorance about the science of medicines.”

http://www.drug-dissolution-testing.com/blog/files/science-of-medicines.pdf 

Post Title with hyperlinks (COVID, virus, pandemic related) 6/11/21

http://www.drug-dissolution-testing.com/blog/files/Post-Title-COVID.pdf 

COVID-19: Science has not been followed Claims vs. reality or facts! 6/11/21

http://www.drug-dissolution-testing.com/?p=3881 

An inconvenient truth w/Andy Kaufman 6/28/21

https://drive.google.com/drive/folders/1yFN2q6oqLYktzUacN4OIQ-J4gTXahRDa 

SAEED QURESHI, UNSUNG HERO. Logical Conclusion: Invalid Test, No Valid Results

https://truthsummit.info/i/saeed-qureshi.html 

COVID and vaccines – ask and listen

https://bioanalyticx.com/covid-and-vaccines-ask-and-listen/ 

(Video) Virus, COVD-19, And Testing – Absence Of Science Saeed Qureshi 3/18/22

https://bioanalyticx.com/virus-covd-19-and-testing-absence-of-science/ 

Not Covid-19 – Worry About Test Positives! 3/22/22

https://bioanalyticx.com/not-covid-19-worry-about-test-positives 

Dr. Qureshi is an internationally recognized scientist. For the past 40 years, including 30 years with Health Canada, he has been involved in the isolation, characterization, and testing of food and pharmaceutical substances.  Dr. Qureshi obtained his Ph.D. under the guidance of (late) Prof. M. Verzele (University of Ghent, Belgium), a world-renowned scientist in separation and isolation science using techniques such as counter-current distribution (CCD) technique and modern techniques of chromatography (gas and liquid) coupled with mass spectrometry.  Since the start of the COVID-19 pandemic episode, he has been educating and guiding people about the unfortunate use of false, in fact, fraudulent science in virus isolation, testing, and vaccine development.   In this podcast, Dr. Qureshi gives a thought provoking presentation about the science, or lack thereof, in regards to virus isolation, v*ccin*e efficacy and the issues plaguing PCR testing. 7/4/22

https://www.humanley.com/blog/episode57 

Dr. Sadaf Gilani

Dr. Sadaf Gilani of Ottawa, Canada has carefully researched COVID-19 and the "virus" that supposedly caused it since the beginning of the lockdowns. In this conversation we cover the field regarding the virus, the testing, the lockdowns, the bioweapon question, and the injections. What are we facing? 6/23/21

https://www.podomatic.com/podcasts/progressivespirit/episodes/2021-06-23T08_56_41-07_00 

https://progressivespirit.net/2021/06/23/sadaf-gilani-inconvenient-truths-about-sars-cov-2/

Dr. Trozzi

Here you will find a collection of medicine and health related articles and videos produced by 25 year veteran MD, Dr. Trozzi, as well as other resources that he recommends.

https://drtrozzi.com/ 

Let us discuss the ethical and financial conflicts faced by doctors, nurses, and other health care professionals in the context of what I, like many, consider to be the “criminal covid enterprise”.

https://drtrozzi.com/doctors-nurses-ethics-law/ 

In my emergency department work, I have never seen a patient sick with COVID-19; I have seen some positive PCR tests in asymptomatic people, and watched people be imprisoned in their own homes and isolated from family and friends.

https://drtrozzi.com/dr-trozzi-covid-19-testimony 

Dr Wil Trebing

William Trebing, DC - Goodbye Germ Theory Reviews

https://www.youtube.com/watch?v=WSFfBxYFKuw 

Goodbye Germ Theory with Dr Will Trebing 2/24/22

https://odysee.com/@DrAndrewKaufman:f/GoodbyeGermTheorywithDrWillTrebing1:9 

William Trebing, DC-Good Bye Germ Theory Ch 1 Pt 1

https://www.youtube.com/watch?v=8AqEDGaM2Qc 

William Trebing, DC-Good Bye Germ Theory Ch 1 Pt 2

https://www.youtube.com/watch?v=hOuPGdeerOI 

William Trebing, DC-Good Bye Germ Theory Ch 1 Pt 3

https://www.youtube.com/watch?v=w3lr84_7aDE 

William Trebing, DC-Good Bye Germ Theory Ch 1 Pt 4

https://www.youtube.com/watch?v=M38kj1x6h28 

William Trebing, DC-Good Bye Germ Theory Ch 1 Pt 5

https://www.youtube.com/watch?v=biVO7OpuETE 

William Trebing DC Good Bye Germ Theory Ch 1 Pt 6

https://www.youtube.com/watch?v=j3Qxofceg2k 

William Trebing, DC-Good Bye Germ Theory Ch 1 Pt 7

https://www.youtube.com/watch?v=6bpJgglUdnY 

William Trebing, DC-Good Bye Germ Theory Ch 1 Pt 8

https://www.youtube.com/watch?v=dMxtZltesMo 

Hanik Health Summit - Wil Trebing

https://www.youtube.com/watch?v=wtLmFPLjOdM&feature=youtu.be

Northern Tracey

Proteins, Spikes and Bio-weapons.

https://northerntracey213875959.wordpress.com/2021/06/09/proteins-spikes-and-bio-weapons 

The Amino Age and The New abNormal Doctors

https://northerntracey213875959.wordpress.com/2021/06/30/the-amino-age-and-the-new-abnormal-doctors 

Sci-fi or Sci-fact?

https://northerntracey213875959.wordpress.com/2021/07/11/sci-fi-or-sci-fact 

The article that got me banned from facebook

https://odysee.com/@northerntracey:a/articles:b 

14 Things You Never Knew About Polio

https://blurt.blog/informationwar/@northern-tracey/14-things-you-never-knew-about-polio 

Virology is dead 10/27/21

https://blurt.blog/instablurt/@northern-tracey/virology-is-dead

Contagion- Fact Checked

https://northerntracey213875959.wordpress.com/2021/05/14/contagion-fact-checked/

Dawn Lester & David Parker What Makes You Ill

Infectious Diseases – Dispelling The Myths - What Really Makes You Ill

https://whatreallymakesyouill.com/infectious-diseases-dispelling-the-myths/

Contagion & Infection – Deceptive Appearances

https://whatreallymakesyouill.com/contagion-infection-deceptive-appearances/ 

Dawn Lester & David Parker: More People Have Woken Up Now Than Ever Before 9/6/22

https://odysee.com/@drsambailey:c/Dawn-Lester-and-David-Parker-Interview:1

COVID: An Overview 4/14/21

https://whatreallymakesyouill.com/covid-an-overview/ 

COVID: The Plot Thickens 5/12/21

https://whatreallymakesyouill.com/covid-the-plot-thickens/ 

Our interview with Clive Menzies 4/16/21

https://whatreallymakesyouill.com/our-interview-with-clive-menzies/ 

Our interview with Patrick Timpone in which we discuss the lack of evidence that any disease is infectious or contagious 11/3/20

https://whatreallymakesyouill.com/interview-by-patrick-timpone-on-the-one-radio-network 

Roundtable discussion on Freedom Broadcasters 4/20/21

https://whatreallymakesyouill.com/roundtable-discussion-on-freedom-broadcasters/ 

Dawn Parker and David Lester, talk about what they have discovered after 10 years of researching what really makes us sick. 3/29/21

https://www.humanley.com/blog/episode26

Interview with Team Cirucci 4/22/21

https://whatreallymakesyouill.com/interview-with-team-cirucci/ 

Dawn and David take apart mainstream thinking on everything from Smallpox to Corona Virus 2/3/21

https://www.bitchute.com/video/8RNktacproOZ/ 

THERE IS NO EVIDENCE THAT ANY VIRUS CAUSES ANY DISEASE 1/22/21

https://www.bitchute.com/video/JFCAQSyVieY1 

The Secret Teachings – Shot Felt Round the World w. Dawn Lester & David Parker 12/21/20

https://whatreallymakesyouill.com/shot-felt-round-the-world-w-dawn-lester-david-parker/ 

Ep.201 | Interview with Dawn Lester and David Parker - What really makes you ill? 1/21/21

https://lbry.tv/@adrianr:8/ep-201-interview-with-dawn-lester-and:d 

Interview with Ryan Martin of Revive Yourself 11/30/20

https://whatreallymakesyouill.com/interview-with-ryan-martin-of-revive-yourself/ 

The Secret Teachings 10/29/20 – Haunted Health

https://whatreallymakesyouill.com/the-secret-teachings-10-29-20-haunted-health-w-dawn-lester-and-david-parker 

Truthiverse with Brendan D Murphy (video) - What Really Makes You Ill 10/3/20

https://whatreallymakesyouill.com/truthiverse-with-brendan-d-murphy-video/

Truthiverse with Brendan D Murphy: What Really Makes You Ill? 9/24/20

https://whatreallymakesyouill.com/truthiverse-with-brendan-d-murphy-what-really-makes-you-ill 

No such thing as sexually transmitted disease

https://whatreallymakesyouill.com/theres-no-such-thing-as-a-sexually-transmitted-disease-2-2

Dawn Lester & David Parker | What Really Makes Us Ill, Germ Theory, & The Four Factors

https://www.mixcloud.com/thehighersidechats/dawn-lester-david-parker-what-really-makes-us-ill-germ-theory-the-four-factors/

Dawn Lester & David Parker | What Really Makes Us Ill, Germ Theory

https://news-intech.blogspot.com/2020/02/dawn-lester-david-parker-what-really.html

What Really Makes Us Ill w/ David Parker & Dawn Lester – Alfa Vedic & Barre Lando

https://www.youtube.com/watch?v=S5PCwS5qg_w

The Germ Theory a Deadly Fallacy

https://www.whatreallymakesyouill.com/germtheory.html

Infectious Diseases – Dispelling The Myths

https://www.whatreallymakesyouill.com/infectiousdisease.html 

What Really Makes You Ill #2 w/ Dawn and David, Non-Communicable Diseases

https://www.youtube.com/watch?v=2ObpIhOFNF4

What Really Makes You Ill w/ Dawn and David

https://www.bitchute.com/video/TORel19zI2A2/ 

Smallpox: Dispelling A Popular Myth - What Really Makes You Ill

https://whatreallymakesyouill.com/smallpox-dispelling-a-popular-myth/ 

Chat w/Dawn, David and Bob about the fact that you can't catch a cold/flu 8/14/20

https://www.facebook.com/billywatsontv/videos/666460034220272/?t=9 

Dawn Lester & David Parker Debunking Bossche Billy Watson tv 4/2/21

https://www.facebook.com/bob.incognitto.35/videos/144244404283915

Billy Watson TV - Dawn Lester & David Parker 7/20/20

https://www.youtube.com/watch?v=tlJrAGYmAnk 

Interview with Dawn Lester and David Parker by Bob Stagnitto 9/10/10

https://www.bitchute.com/video/NbsVDMBvOhco/

Exposing more establishment lies and deceptions: with Bob Stagnitto 10/13/20

https://whatreallymakesyouill.com/exposing-more-establishment-lies-and-deceptions-with-bob-stagnitto-dawn-lester-david-parker/

Authors Dawn Lester & David Parker 10/15/20

https://mailchi.mp/alfavedic/alfacast-dawnlester-davidparker

Why Do People Believe The Mainstream Narrative? Dawn Lester & David Parker 10/16/20

https://whatreallymakesyouill.com/why-do-people-believe-the-mainstream-narrative-w-dawn-lester-david-parker/

Veritas TV - What Really Makes You Ill 10/16/20

https://whatreallymakesyouill.com/interview-on-veritas-tv/

The Real Tragedy of Tuskegee 10/17/20

https://whatreallymakesyouill.com/the-real-tragedy-of-tuskegee 

Grace Asagra Interviews Dawn Lester on the Quantum Nurse Podcast 3/11/21

https://whatreallymakesyouill.com/grace-asagra-interviews-dawn-lester-on-the-quantum-nurse-podcast/ 

Website

https://whatreallymakesyouill.com/ 

Ask to be Contacts at MeWe

https://mewe.com/i/dawnlester1

Dawn Lester and David Parker Our second interview with Amandha Vollmer 5/7/21

https://whatreallymakesyouill.com/our-second-interview-with-amandha-vollmer/ 

Our Interview on Ask the Nurses Podcast 5/24/21

https://whatreallymakesyouill.com/our-interview-on-ask-the-nurses-podcast 

Our third interview with Team Cirucci 6/7/21

https://whatreallymakesyouill.com/our-third-interview-with-team-cirucci 

Conversation with Johnny Cirucci and Billy Watson 6/21/21

https://whatreallymakesyouill.com/conversation-with-johnny-cirucci-and-billy-watson/ 

Dawn Lester - The Weaponization of Medicine 6/21/21

https://odysee.com/@dawnofpeace:5/Dawn-Lester---The-Weaponisation-of-Medicine:d 

Podcast interview by Jeff Sekerak 6/29/21

https://whatreallymakesyouill.com/podcast-interview-by-jeff-sekerak/ 

Our interview on The Way Forward podcast 7/30/21

https://whatreallymakesyouill.com/our-interview-on-the-way-forward-podcast 

Adam interviews Dawn Lester for the second time for the Crazz Files podcast

https://whatreallymakesyouill.com/adam-interviews-dawn-lester-for-the-second-time-for-the-crazz-files-podcast/

Our conversation with Ben and Mike for their Terrain Theory podcast

https://whatreallymakesyouill.com/our-conversation-with-ben-and-mike-for-their-terrain-theory-podcast/

Disease Madness – What is Happening? Part 1 6/30/22

https://whatreallymakesyouill.com/disease-madness-what-is-happening-part-1/

Antibodies & Immunity: Dispelling Two More Myths 7/18/22

https://dawnlester.substack.com/p/antibodies-and-immunity-dispelling 

Monkeypox: Yet More Madness 7/24/22

https://dawnlester.substack.com/p/monkeypox-yet-more-madness 

There’s No Such Thing as a Sexually-Transmitted Disease 7/1/22

https://dawnlester.substack.com/p/theres-no-such-thing-as-a-sexually 

The Real Tragedy of Tuskegee 7/13/22

https://dawnlester.substack.com/p/the-real-tragedy-of-tuskegee 

Get paid for proof of Covid

AN INTERNATIONAL CRIMINAL IS WANTED! ONE MILLION DOLLAR PRIZE

https://www.new-civilization.com/bg/krahat-na-virusn-1-milion-dolara 

1 Million € for the scientific proof of the existence of a coronavirus, including the documented control attempts of all steps taken to provide evidence. 4/14/21

https://www.samueleckert.net/isolat-truth-fund/

The PCR test is inaccurate and cannot detect infectious viruses. 5K reward

https://lbry.tv/@FreedomFighter:a/Dr-OFFERS--5000-FOR-PROOF-THAT-THE-CV19-EXISTS:d?r=AB8GFo4t1JsaPyzBbxymBSAdASGF84ud

The CoronaVirus bet: € 100,000 for virus evidence!

https://www.impfkritik.de/pressespiegel/2020032201.html

CORONAVIRUS GOLD BOUNTY — AceOfCoins Will pay for proof of covid

https://www.aceofcoins.net/blog/corona-virus-gold-bounty

1.8 million offered for proof that the “virus” exists.

https://new.awakeningchannel.com/15-million-e-18-million-reward-for-a-virologist-who-presents-proof-of-the-existence-of-the-coronavirus

VIRAL CHALLENGE LETTER TO BRITISH PRIME MINISTER  

https://kevinpcorbett.com/coronahysteria/viral-challenge-letter-to-british-prime-minister.html

Where is the evidence of the existence of covid 19

https://kevinpcorbett.com/onewebmedia/WHERE%20IS%20THE%20EVIDENCE%20FOR%20THE%20EXISTENCE%20OF%20THE%20CORONAVIRUS%20FINAL.pdf

THE ‘COVID NAZIFICATION’ OF THE NHS

https://www.kevinpcorbett.com/coronahysteria/the-nazification-of-the-national-health-service.html

Bustin S Nolan T (2017) Talking the talk, but not walking the walk: RT‐qPCR as a paradigm for the lack of reproducibility in molecular research. European Journal of Clinical Investigation: https://doi.org/10.1111/eci.12801

Cao S, Wu A, Li J et al.(2020) Recurrent recurrence of positive SARS-CoV-2 RNA in a COVID-19 patient, April 15, PREPRINT (Version 1) available at Research Square.

https://doi.org/10.21203/rs.3.rs23197/v1

Corbett K (2018) The Regulation of British HIV Testing, 1985-2003. London, KPC Research and Consultancy Ltd.www.kevinpcorbett.com Corbett, K (2001) Contesting AIDS/HIV: the lay reception of biomedical knowledge. Unpublished PhD thesis, London South Bank University   https://lispac.lsbu.ac.uk/record=b1015575~S1

Corbett, K (2009) “You’ve got it, you may have it, you haven’t got it”: multiplicity, heterogeneity, and the unintended consequences of HIV-related tests. Science, Technology and Human Values, 34 (1), pp. 102-125. ISSN 0162-2439.

http://dx.doi.org/doi:10.1177/0162243907310376

Corbett K, Crowe D (2020) Problems with current UK government lockdown policy. Journal of Advanced Nursing interactive.

https://journalofadvancednursing.blogspot.com/2020/04/problems-withcurrent-uk-government.html

Crowe D (2020a) Flaws in Coronavirus Pandemic Theory

https://theinfectiousmyth.com/book/CoronavirusPanic.pdf

Crowe D (2020b) The Infectious Myth - Simplifying RT-PC.R. The Infectious Myth, April 21.  

https://theinfectiousmyth.com/coronavirus/RT-PCR_Test_Issues.php

Crowe D (2020c) The Incredible and Scary Truth about COVID-19 Tests. London, Lockdown Skeptics April 26

https://lockdownsceptics.org/the-incredible-and-scary-truth-about-covid-19-tests-2/

Donnelly L, Gardner B (2020) Revealed: NHS staff given flawed coronavirus tests Leaked memo exposes farce as Covid-19 results are less reliable than first thought because of 'degraded' performance. April 21. London.

https://www.telegraph.co.uk/news/2020/04/21/public-healthengland-admits-coronavirus-tests-used-send-nhs/

Griner PF, Mayewski RJ, Mushlin AI (1981) Selection and interpretation of diagnostic tests and procedures. Annals of Internal Medicine 94:559-563. Ham C, Baird C, Gregory S, Jabbal J, Alderwick H (2015) The NHS under the coalition government. London, King’s Fund.   

https://www.kingsfund.org.uk/sites/default/files/field/field_publication_file/the-nhsunder-the-coalition-government-part-one-nhs-reform.pdf

Health and Social Care Act (2012) Health and Social Care Act. London, Her Majesty’s Govt

http://www.legislation.gov.uk/ukpga/2012/7/contents/enacted

Page 11 of 13 Heneghan C, Jefferson T (2020) COVID-19 deaths compared with “Swine Flu”. Oxford University and The Centre for Evidence-Based Medicine develops, promotes and disseminates better evidence for healthcare. April 9,

https://www.cebm.net/covid-19/covid-19-deaths-compared-with-swine-flu/

Huang C et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet. 2020 Jan 24.

https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30183-5/fulltext

Kaufman A (2020) Dr. Andrew Kaufman: Is COVID-19 an Exosome?

https://hipegalaxy.com/covid19/dr-andrew-kaufman-is-covid-19-an-exosome/

Kuhn, Thomas S. (2012). The Structure of Scientific Revolutions. 50th anniversary. Ian Hacking (intro.) (4th ed.). University of Chicago Press. Langmuir I (1953) Pathological Science. Colloquium at The Knolls Research Laboratory Niskayuna, New York City, New York, December 18, 1953. Transcribed and edited by R. N. Hall.

https://www.cs.princeton.edu/~ken/Langmuir/langmuir.htm

Li, Y, Yao, L, Li, J, et al. (2020) Stability issues of RT‐PCR testing of SARS‐CoV‐2 for hospitalized patients clinically diagnosed with COVID‐19. Journal of Medical Virology, 1– 6.

https://doi.org/10.1002/jmv.25786

NHS England and NHS Improvement (2020) Guidance and standard operating procedure COVID-19 virus testing in NHS laboratories. London, NHS England and NHS Improvement.    

https://www.england.nhs.uk/coronavirus/publication/guidance-and-standard-operating-procedure-covid19-virus-testing-in-nhs-laboratories/

OffGuardian (2020) 12 Experts Questioning the Coronavirus Panic.

https://offguardian.org/2020/03/24/12-experts-questioning-the-coronavirus-panic/

Ogenstad S, Peace K, Liu L (2020) Accurate COVID-19 Testing in Clinical Trials. Unpublished paper submitted to Journal of Biopharmaceutical Statistics. Papadopulos-Eleopulos, E et al.(2012) HIV – A virus like no other. Posted at the Perth Group website July 12th.  

www.theperthgroup.com/HIV/TPGVirusLikeNoOther.pdf

Pollock A, Macfarlane A, Godden S (2012) Dismantling the signposts to public health? NHS data under the Health and Social Care Act 2012.

https://www.bmj.com/content/344/bmj.e2364

Roche (2020) Covid-19 Factsheet. Cobas®-SARS-CoV-2. Fact Sheet. Roche Molecular Systems Inc., Pleasanton, California.

https://www.fda.gov/media/136047/download 

Schierwater B, Metzler D, Kreuger K, Streit B (2009) The effects of nested primer binding sites on the reproducibility of PCR: mathematical modeling and computer simulation studies. Journal of Computational Biology 3, 235–51. Smyth C, Kennedy D, Kenber B ( 2020). "Britain has millions of coronavirus antibody tests, but they don't work" London April 6. 

https://www.thetimes.co.uk/article/britain-has-millions-of-coronavirusantibody-tests-but-they-don-t-work-j7kb55g89

Page 12 of 13 University of Maryland (2020) Koch’s Postulates to Identify the Causative Agent of an Infectious Disease.  

http://science.umd.edu/classroom/bsci424/BSCI223WebSiteFiles/KochsPostulates.htm

White DO, Fenner FJ. (1986) Medical Virology. San Diego, Academic Press. Young BE et al. Epidemiologic Features and Clinical Course of Patients Infected With SARSCoV2 in Singapore. JAMA. 2020 March 3.

https://jamanetwork.com/journals/jama/fullarticle/2762688

Dear humans: face masks don’t work; the study-review was published by your very own CDC

https://blog.nomorefakenews.com/2020/07/20/face-masks-dont-work-study-published-by-your-very-own-cdc/

Prof. George Vithoulkas

Prof. George Vithoulkas is interviewed by Dr. Manish Bhatia about his theories of health and disease including his recent teachings on the role of the microbiome in chronic diseases.

https://hpathy.com/homeopathy-interviews/the-role-of-microbiome-in-chronic-diseases-prof-george-vithoulkas-interviewed-by-dr-manish-bhatia 

Dr. Andrew Kaufman

Hippocratic Hypocrisy

https://www.youtube.com/watch?v=wbigfSB1_Yg

'Viruses' - Baileys, Cowan & Kaufman Respond To Del Bigtree 9/6/22

https://odysee.com/@drsambailey:c/Viruses-Baileys-Cowan-Kaufman-Respond-To-Del-Bigtree:b

The Way Forward presents a live summit to dissect and debunk the monkey business surrounding both monkeypox and the theory of pathogenic viruses at large. Drr Mark & Sam Bailey Dr. Kevin Corbett, Dr Cowan, Dr Kaufman, Dr Saeed Qureshi, Dr. Amanda Vollmer, Mike Stone, Alex Zeck, Christine Massey, Eric Coppolino 6/1/22

https://besovereign.com/the-way-forward/the-way-forward/01-jun-16-00-monkeypox-mania# 

DENBY DOES DHARMA PODCAST: A COMMON SENSE CONVERSATION WITH DR. TOM COWAN & DR. ANDREW KAUFMAN 5/24/22

https://www.bitchute.com/video/XkJN99W4DUM5/ 

No More Monkey Business Andrew Kaufman, M.D. 5/26/22

https://odysee.com/@DrAndrewKaufman:f/No_More_Monkey_Business:3

VIRUS-ISOLATION IS IT REAL? ANDREW KAUFMAN MD RESPONDS TO JEREMY HAMMOND 1/20/22

https://www.bitchute.com/video/UnpfmjmXNH0O 

DR. KAUFMAN EXPOSES THE CURRENT HIV/AIDS COVID CONNECTION AGENDA - VACCINE DEATHS & TERRAIN THEORY! 2/28/22

https://www.bitchute.com/video/xo0wKNYCliY1/ 

Jacklin invites Andrew Kaufman, M.D. to the Jackal’s Den to further illuminate inconsistencies with the scam called COVID-19. Dr. Andy describes his personal journey that led him to major realizations and dispels misinformation about disease and sickness. 5/23/22

https://rumble.com/v14e2j4-the-germ-theory-and-the-scamdemic-with-ian-jacklin.html 

Dr. Andrew Kaufman, Germs, Disease & The Science with Alec Zeck 11/1/21

https://besovereign.com/the-way-forward/the-way-forward?recording_id=253

The Pete Santilli Show Episode 2745 with special guest Dr. Andrew Kaufman (Covid19 Whistleblower) who gives a very powerful interview about Covid19, the hospital protocols, and more! 12/27/21

https://rumble.com/vr7p5s-dr.-andrew-kaufman-there-is-no-disease-such-as-covid19.html 

DR. ANDREW KAUFMAN, MD AND A BRIEF HISTORY OF IMPORTANT MEDICAL TOPICS - NMA EPISODE 009 1/3/22

https://www.bitchute.com/video/fcoyMcAM0x5y 

Humanley Show - Interview with Dr. Andrew Kaufman 2/5/22

https://rumble.com/vtxjqw-humanley-show-interview-with-dr.-andrew-kaufman.html 

The Pete Santilli Show Episode 2745 with Dr. Andrew Kaufman (Covid19 Whistleblower) who gives a very powerful interview about Covid19, the hospital protocols 12/29/21

https://www.bitchute.com/video/2iZcjx9yjPmI 

Are Germs the enemy 5/25/20

https://www.westonaprice.org/podcast/242-are-germs-the-enemy 

Dr Andy Kaufman website

https://www.andrewkaufmanmd.com/videos-episodes-medicamentum-authentica/

New COVID ‘Scariant’: Fact or Fiction with Dr. Kaufman 11/29/21

https://besovereign.com/greenmedinfo/greenmedinfo-free-787/28-nov-14-00-new-covid-scariant-fact-or-fiction-with-dr-kaufman?video_id=200 

Dr Kaufman speaks in London 9/19/20

https://www.bitchute.com/video/OjeAxEMevQdg/

DR KAUFMAN discusses COVID19 & PCR TEST w/Clive de Carle 8/5/20

https://www.bitchute.com/video/GEyozEcjcSUS/ 

Owen Benjamin interviews Dr.Andrew Kaufman #mirror

https://www.youtube.com/watch?v=BTo443mE4zE

Dr. Andrew Kaufman: Philosophy and Science in Crisis with Elisha Celeste

https://www.youtube.com/watch?v=ll__gWch99E

Dr Andy Kaufman answers your questions with RFB

https://www.youtube.com/watch?v=I5GFB8bJhU4&feature=youtu.be

Experiments demonstrate no contagion with Spanish Flu Dr. Kaufman

https://www.youtube.com/watch?v=bk-CLvaZQO0&feature=youtu.be

Dr Kaufman reports the Frankenstein Viral Genome Sequence Fraud w/Jason Liosatos

https://www.youtube.com/watch?v=vPtnB4FljjI&feature=youtu.be

Part 1 How betrayal and global pandemic aligned. Dr Andy Kaufman

https://www.youtube.com/watch?v=8V-YTq_SBjM&feature=youtu.be

Dr Andy Kaufman on Highwire talks about Germ Theory is false

https://www.youtube.com/watch?v=06hFyHaivHc&feature=youtu.be

Dr. Kaufman videos on Bitchute

https://search.bitchute.com/renderer?query=Andrew+Kaufman

Dr Kaufman with Jennifer Daniels

https://www.andrewkaufmanmd.com/vids/Dr.%20Daniels%204-23-20.mp4

Dr Kaufman with NY Attorney Bob Unger

https://www.youtube.com/watch?v=VPMcP44-Z0k&feature=youtu.be

Dr. Andrew Kaufman & Amandha Vollmer Current Scientific Revolution & Gathering The Tribes

https://www.youtube.com/watch?v=eaibhLLnDy8&feature=youtu.be

Dr Andrew Kaufman exposing the 'Covid-19' magic trick!

https://www.youtube.com/watch?v=2Op5-Nv2hb0&feature=youtu.be

CV 19 Test Results are Meaningless 100% Scientific Proof

https://www.youtube.com/watch?v=Uana-QIQJaQ&feature=youtu.be

Truthiverse Episode 4: Dr Andrew Kaufman Unleashed with Brendan D. Murphy

https://www.youtube.com/watch?v=AmFqBc3gPjM

https://truthiverse.com/4 

Dr Andy Kaufman transcript from Brendan Murphy interview

https://assets.fireside.fm/file/fireside-images/podcasts/transcripts/3/3ffd4e91-c80e-4ccd-af21-215dafb416a8/episodes/2/21f52a97-be9b-41f3-913c-35271d53f33e/transcript.txt

Woke Dr answers all your questions with RFB

https://www.youtube.com/watch?v=IM-PPfHDRYU

The Worlds Greatest Cover-up, Dr. Andy Kaufman

https://youtu.be/QMwv_iivFC4 

Dr Andy Kaufman blows whistle on medical system and pandemic

https://truthiverse.com/4 

A breakdown on current testing procedures. Dr. Kaufman

https://www.youtube.com/watch?v=Xr8Dy5mnYx8&feature=youtu.be 

Dr Kaufman shows picture of exosomes

https://i.postimg.cc/mgM76MkG/exosomes.jpg

RFB interviews Dr Andy Kaufman 3/21/20

https://www.youtube.com/watch?v=8j2l04Dqbuo 

Questioning Covid-19 with Dr. Andrew Kaufman, Dr. Kelly Brogan, and Dr. Barre Lando

https://youtu.be/Eed3uBM3G_w 

Dr. Andy Kaufman roundtable with Dr. Tenpenny

https://www.youtube.com/watch?v=V66H3BdJMoI&feature=youtu.be 

Dr Andy Kaufmann with Spiro May 10th discusses covid vaccine

https://www.youtube.com/watch?v=qy5FD0XameI&feature=youtu.be 

https://www.bitchute.com/video/r9MG7YY5CrpL/

The Healthy Truth with Dr. Andy Kaufman with Maya

https://www.youtube.com/watch?v=_v2XWuPY09M 

Dr Andy Kaufman interview with David Crowe

https://www.podbean.com/eu/pb-cyay6-db7a61 

Dr Kaufman Covid theory you are not allow to hear w/American Vagabond

https://www.youtube.com/watch?v=wsjSuqCj3Bo 

Dr Andy Kaufman Exosomes are viral particles, part of our immune system

https://www.bitchute.com/video/36QfZ76PZVue 

BLOOD DIARIES 7: Dr Andrew Kaufman on Terrain Theory 8/16/20

https://youtu.be/XGMfQGHP5RI 

Dr. Kaufman helps us wrap our heads around germ theory & contrasts it with terrain theory

https://wisetraditions.libsyn.com/242-are-germs-the-enemy 

Dr. Andy Kaufman Rogue Ways 3/30/20

https://www.youtube.com/watch?v=68mYx9hdao4&feature=youtu.be

The anatomy of Covid 19 with Dr. Kaufman w/James True

https://www.youtube.com/watch?v=GWRbIIaPV78 

RFB interviews Dr. Kaufman who answers your questions 5/21/20

https://www.youtube.com/watch?v=L7DTy5sCu6c&feature=youtu.be   

COVID Reveals Pathology of Scientific Materialism & Need to (re)THINK Health Mobile Mastery

https://www.youtube.com/watch?v=8JPrYNOJ0Ys&feature=youtu.be 

A timely discussion with Sophia Smallstorm and Dr. Kaufman

https://www.youtube.com/watch?v=xUtPjSfPo-g&feature=youtu.be 

Dr. ANDREW KAUFMAN  "A DOCTOR SPEAKS OUT: April 28th

https://www.youtube.com/watch?v=APaUEgfeAYE&feature=youtu.be

Dr. Andrew Kaufman The Truth About Viruses & Infectious Diseases! 7/30/20

https://www.youtube.com/watch?v=DA6IrqfkGT0&feature=youtu.be

Live With Medical Doctor ANDREW KAUFMAN RFB - 7/30/20

https://www.youtube.com/watch?v=SptsG2W8tdc&feature=youtu.be 

Dr Kaufman joins The HighWire to share a very inconvenient truth regarding "SARS-CoV-2"

https://www.bitchute.com/video/5n7Yfo7vkJAe/

Dr. Andrew Kaufman w/ Clive de Carle on Nutrients and Devices 8/18/20

https://www.youtube.com/watch?v=P8UUI3FHGdU&feature=youtu.be

Virus' test revelations with David Icke and Andrew Kaufman 8/24/20

https://www.bitchute.com/video/4bwTCk5pOiup/

Dr. Andrew Kaufman & Marty Leeds 9/3/20

https://www.youtube.com/watch?v=R8QCdtBRZ2U&feature=youtu.be 

Dr. Kaufman w/ Adam and Josh Bigelsen on Terrain Theory 8/27/20

https://www.youtube.com/watch?v=HqU33GhobDw&feature=youtu.be 

Dr Kaufman Talks Psychology, Expert Observation of Covid -Reinette Senum 9/10/20

 https://www.youtube.com/watch?v=vWDyWG6yfb0 

Dr. Andrew Kaufman background

https://www.weblyf.com/2020/04/who-is-dr-andrew-kaufman-and-his-professional-background/

The Surprising Truth about Viral Cultures with Dr. Andrew Kaufman

https://www.youtube.com/watch?v=S2cPqCod6BM&feature=youtu.be 

Operation MoonShot 9/30/20

https://lbry.tv/Dr-Andrew-Kaufman-w-David-Icke-on-False-Positives-and-Operation-Moonshot:5 

https://www.bitchute.com/video/3zRoVmLaGM5K/ 

Opinion of current events

https://i.postimg.cc/sX5v7jJZ/Dr-Kaufman-opinion-of-current-events.jpg 

Dr Andrew Kaufman PCR Testing False Positives - COVID-19 Interview with Jason Liosatos

https://www.youtube.com/watch?v=72Q_4rRO_2A&feature=youtu.be 

Dr Kaufman speech to Denmark 11/23/20

https://www.bitchute.com/video/00haCQH4YpPy/ 

Andrew Kaufman, MD, addresses the Red Pill Expo and conducts what amounts to a basic course in virology. 11/18/20

https://bittube.video/videos/watch/cfe831f1-6254-403e-8ee2-6c7fd56099a6 

Dr Andrew Kaufman blows the whistle and scientifically debunks masks, tests and jabs 11/25/20

https://www.bitchute.com/video/RIsyOR8ZUQxT 

Dr. Barre Lando on Waves and Pleomorphism 11/26/20

https://www.youtube.com/watch?v=KiUcXgGHg9I&feature=youtu.be 

A Discussion on GNM w/Andi Locke Mears and Melissa Sell 12/28/20

https://www.youtube.com/watch?v=TOT1ZCKbHQw&feature=youtu.be 

There are no viruses. Dr Kaufman corrects Dr Mikovits that they’ve never been isolated proven to cause dis-ease 1/23/21

https://www.bitchute.com/video/GAaMnBq6wbbA/ 

Dr. Andrew Kaufman in Denmark World Freedom Alliance

https://lbry.tv/@DrAndrewKaufman:f/WAKE-UP-CALL---Dr.-Andrew-Kaufman-(without-Zac):1 

Witnessing Massive Cult Behavior, Cannot Take in Facts, Not Acting in Best Interest w/ Dr. Kaufman 2/15/21

https://lbry.tv/@sarahwestall:0/Andy-Kaufman:8 

Death of the germ theory 3/2/21

https://odysee.com/@DrAndrewKaufman:f/Death-Of-Germ-Theory-Sacha-Stone-LBRY-2-26-21-1:c 

Dr. Andrew Kaufman to discuss the most relevant topic of our times: masking, our kids health, testing, social distancing, and the state of the medical system today. 3/10/21

https://www.bitchute.com/video/Zvd3eSI3wYik/ 

New Live Q&A Webinar Dr. Kaufman 3/12/21

https://www.youtube.com/watch?v=BbZnMQgVxwM 

Witnessing Massive Cult Behavior, Cannot Take in Facts, Not Acting in Best Interest w/ Dr. Kaufman 3/16/21

https://lbry.tv/@FwapUK:1/Andrew-Kaufman-Witnessing-Massive-Cult-Behaviour,-Cannot-Take-In-Facts,-Not-Acting-in-Best-Interest!:1 

Dr. Andrew Kaufman covers all the technicalities of this scamdemic extremely well! With Lillian Wafimbi 4/16/21

https://www.facebook.com/bob.incognitto.35/videos/153469046694784 

This is a discussion regarding the covid vaccine tyranny in Israel with Dr. Kaufman, Israeli activist Ilana Rachel Daniel, and host Gal Shelev. 4/23/21

https://odysee.com/@DrAndrewKaufman:f/Gal-Shelev-Rachel-Daniel:b 

Historical Parallels - Vera Sharav and Dr. Andrew Kaufman 5/5/21

https://lbry.tv/@Truth_will_set_You_Free:0/Vera-Sharav-4-21-21:9 

The 411 with Dr. Andrew Kaufman - Mana Talk 5/12/21

https://lbry.tv/@Truth_will_set_You_Free:0/The-411-w_-Dr.-Andrew-Kaufman:7 

Journalist Derrick Broze interviews doctors Andrew Kaufman and Thomas Cowan about the isolation and purification of COVID19.

https://lbry.tv/@DrAndrewKaufman:f/326182206_Has-COVID19-Been-Isolated-with-Dr.-Andrew-Kaufman-and-Dr.-Thomas-Cowan--Jour...-963108570762892-(1):1 

Andrew Kaufman MD joins us to talk all things COVID Bits and Bobs 5/21/21

https://brandnewtube.com/watch/dr-andrew-kaufman-the-truth-about-covid-20-05-2021_6Qa6qtwi6iomtnz.html 

Dr Andrew Kaufman | Shedding light on Science and Spirituality with Denby Sheather

https://brandnewtube.com/watch/dr-andrew-kaufman-shedding-light-on-science-and-spirituality-with-denby-sheather_uBywgDwsNKeoM9h.html 

Dr Andy Kaufman chats with Courtenay, Dirk, and Trina 6/22/21

https://odysee.com/@WarriorForTruth:4/Dr-Andy-Kaufman-chats-with-courtenay,-dirk,-and-trina:e 

If there is no SarsCov2 virus, then what is GOF? Please listen to Dr. Kaufman's answer. 6/28/21

https://drive.google.com/drive/folders/1yFN2q6oqLYktzUacN4OIQ-J4gTXahRDa 

DR. ANDY KAUFMAN interview with millennial ON COVID-1984

https://www.bitchute.com/video/mKJo4t9ZIUJs/ 

COVID UNDERGROUND ANDY KAUFMAN ON TOM COWAN - PLEOMORPHISM, TERRAIN THEORY GERM THEORY DENIALISM

https://www.bitchute.com/video/ggumztiH5DQU/ 

Viral Theory and its Scientific Flaws with Dr. Andrew Kaufman 7/15/21

https://www.youtube.com/watch?v=pjoQ7hklkQA 

VIRAL SCAM!? EXCLUSIVE INTERVIEW WITH ANDREW KAUFMAN (PART 1) 7/17/21

https://www.bitchute.com/video/bWFaGd4cM2ZJ 

EVERYTHING YOU'VE BEEN TAUGHT IS A LIE! INTERVIEW WITH ANDREW KAUFMAN (PART 2) 7/17/21

https://www.bitchute.com/video/jmDjX14aP4Cf/ 

MIT Scientist Exposes Covid-19 Hoax 7/24/21

https://banned.video/watch?id=60f9f8c273a7b3082db3e9ec 

Search Dr Andy Kaufman on odysee

https://odysee.com/$/search?q=Dr%20Andy%20kaufman 

Dr. Barre Paul Lando & Dr. Andrew Kaufman – Leading Voices In the COVID Truth Movement; A Deep Dive Into the True Cause of Disease 7/24/21

https://oneradionetwork.com/all-shows/dr-barre-paul-lando-a-deep-dive-into-the-true-cause-of-disease-july-21-2021/ 

If You Cannot Question Science, It's Secular Dogma, Propaganda, & a Cult 8/7/21

https://veritasradio.com/guests/2021/08aug/VS-210805-akaufman-facebook.php 

The DELTA Variant is Total FAKE NEWS - Dr. Andrew Kaufman 8/4/21

https://odysee.com/@lancewdetrick:b/IA---The-DELTA-Variant-is-Total-FAKE-NEWS---Dr.-Andrew-Kaufman:a 

Dr. Kaufman Issues Warning: The Delta Fraud, Collectivism and the Road to Freedom 8/11/21

https://freeworldnews.tv/watch?id=61143bd94a5c50474cc7019e 

DR ANDREW KAUFMAN ON TRUE HEALTH IN MIND, BODY & SPIRIT & FALSE DELTA VARIANT 8/23/21

https://www.bitchute.com/video/ukevWP4VNNKi

FDA & PFIZER: SOMETHING WICKED THIS WAY COMES -- DR. ANDREW KAUFMAN 8/25/21

https://www.bitchute.com/video/HzT3x6NrSdED/ 

Covidnosis: How Empire Brainwashed the World 8/26/21

https://freeworldnews.tv/watch?id=6126b22a0b825c6c22e07be1 

Start 15 min mark DR. ANDREW KAUFMAN - FDA, CDC NOR GOVERNMENT COVID ACTIONS HAVE BEEN RATIONAL OR SCIENTIFIC 8/30/21

https://www.bitchute.com/video/F6qsenFxPuS1/ 

Dr. Andrew Kaufman Interview - What Is The True Catalyst Behind COVID-19? 9/7/21

https://odysee.com/@TLAVagabond:5/Dr-Kaufman-Interview-9-3-21:e 

DR ANDREW KAUFMAN AND TIRAMARA WILLIAMS (NEW ZEALAND) 11/22/21

https://www.bitchute.com/video/r5YzflCCLkK9/ 

MEDICAL DOCTOR BLOWS C-VI-RUS SCAMDEMIC WIDE OPEN!!

https://www.bitchute.com/video/IIDths-UdDA/ 

Viral SCAM!? Exclusive Interview with Andrew Kaufman (Part 1)

https://odysee.com/@HighImpactFlix:c/JULY-15-ANDREW-KAUFMAN-INTERVIEW:1 

It's ALL a LIE! Andrew Kaufman Interview - Part 2

https://odysee.com/@HighImpactFlix:c/JULY-15-ANDREW-KAUFMAN-INTERVIEW-2:3 

He began speaking out about his research and what he found out. Here is an early interview where Marshall sits down with Dr. Kaufman to discuss his perspective on what is actually going on with the Covid-19 “pandemic.”

https://rumble.com/vqta1r-marshall-hodge-interviews-dr.-andrew-kaufman-about-covid-19.html 

TRUTH AND CONSEQUENCES WITH DR. VALENTINA KISELEVA 2/4/22

https://www.bitchute.com/video/NNOsTq9cm9Y8 

Hidden Science Greater Cause Of Disease With Andrew Kaufman MD 2/18/22

https://rumble.com/vuyriu-hidden-science-greater-cause-of-disease-with-andrew-kaufman-md.html 

The Straight Unswiveled Truth on Snake Venom Claims with Andrew Kaufman, M.D. 4/18/22

https://odysee.com/@DrAndrewKaufman:f/The_Straight_Unswiveled_Truth_On_Snake_Venom_Claims_with_Andrew_Kaufman_MD:4 

IVERMECTIN: THE TRUE STORY

https://andrewkaufmanmd.com/videos/ivermectin-the-true-story-by-dr-andrew-kaufman

Dr. Andrew Kaufman with Rob Edwards | Medicamentum Authentica 5/26/22

https://odysee.com/@robedward:5/dr.-andrew-kaufman-medicamentum:7 

Kate Sugak interviews Andrew Kaufman 9/2/21

https://odysee.com/@katie.su:7/kateinterviewsandrew:4 

DR ANDREW KAUFMAN : THE LATEST... w/ Veritas 8/12/21

https://odysee.com/@veritas:b/dr-andrew-kaufman-the-latest...:2

Dr Andrew Kaufman - OMICRON Scariant w/ Sayer Ji 12/2/21

https://odysee.com/@TruthVault:0/Dr-Andrew-Kaufman-OMICRON-Scariant:6 

The Rundown Live - 846 - Dr Andrew Kaufman, Propaganda, Lockdown, Texas School Shooting 5/27/22

https://www.onenewspage.com/video/20220525/14671115/The-Rundown-Live-846-Dr-Andrew.htm 

Dr. Andrew Kaufman - Unraveling the Medical and Legal Matrices [King Hero Interview] 2/20/22

https://www.youtube.com/watch?v=wXJwE2PxwM4 

HOW MODERN MEDICINE IS KILLING US WITH ANDREW KAUFMAN, M.D. AND GEMMA O'DOHERTY 6/12/22

https://www.bitchute.com/video/fC88anjV1wU2/ 

A Common Sense Conversation with Andrew Kaufman, M.D. and Dr. Tom Cowan 6/12/22

https://odysee.com/@DrAndrewKaufman:f/A_Common_Sense_Conversation_with_Andrew_Kaufman_MD_and_Dr_Tom_Cowan:6

SCIENCE, HEALTH AND PHILOSOPHY OUTSIDE THE MATRIX WITH DR. ANDREW KAUFMAN 6/12/22

https://www.bitchute.com/video/2I7CeKFdGz7q/ 

The Anti-Cough-Man - A Poppycock-Proof Chat With My Friend Andy 6/17/22

https://rokfin.com/stream/19184/The-AntiCoughMan--A-PoppycockProof-Chat-With-My-Friend-Andy- 

Wine Terroir is Proof of Concept for Terrain Theory with Andrew Kaufman, M.D. 7/26/22

https://rumble.com/v1aiuof-crow777-wine-terroir-is-proof-of-concept-for-terrain-theory-with-andrew-kau.html

Terrain Theory, Pleomorphism and Alchemical Detox with Ben Hardy and Andrew Kaufman, M.D. 10/17/22

https://rumble.com/v1nn1qu-terrain-theory-pleomorphism-and-alchemical-detox-with-ben-hardy-and-andrew-.html

Science vs. Scientism and Hippocratic Hypocrisy With Dani Katz 10/17/22

https://rumble.com/v1mo5nc-science-vs.-scientism-and-hippocratic-hypocrisy-with-dani-katz.html

Terrain Theory, Pleomorphism and Alchemical Detox with Ben Hardy and Andrew Kaufman, M.D 10/27/22

https://rumble.com/v1nn1qu-terrain-theory-pleomorphism-and-alchemical-detox-with-ben-hardy-and-andrew-.html 

JERM WARFARE WITH JEREMY NELL AND ANDREW KAUFMAN, M.D. 10/27/22

https://www.bitchute.com/video/yxSgFwG10r1P/ 

UNPACKING GERM THEORY WITH COURTENAY TURNER AND ANDREW KAUFMAN, M.D. 10/27/22

https://www.bitchute.com/video/wAqI7IOq8GSw/ 

VOICES AND CHOICES FOR FREEDOM WITH BILLY WATSON AND ANDREW KAUFMAN, M.D. 10/31/22

https://www.bitchute.com/video/gi1onKTeNE0o/

TEAM NO VIRUS ON PLANNED ILLUSION: KAUFMAN, COWAN, CORBETT AND BAILEY 10/31/22

https://www.bitchute.com/video/JDdNLQYLR1jc/

Jeremy invites Dr.Andy to share his mission to build a better health system that would be more in tune with nature. From varicose veins to skin problems, Andrew shares how early signs can be used to address health issues before they become full blown illness issues. Jeremy and Dr. Andy discuss the problems with allopathic model of health, discussing the merits of surgery as opposed to the chemicals which do not ever get to the root of health problems. The discussion ranges from Andys’ professional work experience to practical solutions, and eventually comes around to morality. This episode provides a truly holistic approach to medicine and health. 11/22/22

https://vigilante.tv/w/bDc7AASqTLrmzbdtjHqdNo

Dr. Andrew Kaufman " Viruses "

https://odysee.com/@Weezy:a/andrewkaufman1:e

THE TERRAIN OF TRUTH WITH ANDREW KAUFMAN, M.D.

https://www.bitchute.com/video/xqrK3DlJOJ0d/

THE DEPTHS OF TRUE HEALTH WITH ANDREW KAUFMAN, M.D.

https://www.bitchute.com/video/mlW3djK4exXH/

CIA DOCTORS AND HUMAN RIGHTS VIOLATIONS BY ANDREW KAUFMAN, M.D.

https://www.bitchute.com/video/bKWEg9yG0jpL/

BREAKING FREE FROM DECEPTION AND CONTROL WITH ANDREW KAUFMAN, M.D.

https://www.bitchute.com/video/HWhnrcbQytiL/

WHAT IS THE TRUTH ABOUT VIRUSES WITH ANDREW KAUFMAN, M.D.

https://www.bitchute.com/video/RKPcXrifZ2Ww/

BEYOND WESTERN MEDICINE WITH ANDREW KAUFMAN, M.D.

https://www.bitchute.com/video/Yej1N4b4B95L/

Dr Thomas Cowan

All Dr Cowan videos

https://www.bitchute.com/channel/CivTSuEjw6Qp 

Dr. Cowan website

https://www.drcowansgarden.com/pages/about-us

https://drtomcowan.com/

https://drtomcowan.com/contact/ 

Several videos - because its all just a bunch of bullshit as you can see by the items you found   best, Tom

https://drtomcowan.com/podcast/ 

https://drtomcowan.com/videos/ 

https://drtomcowan.com/learning/interviews/ 

Like many of us, he discovered that the foundations of virology are based on anti-scientific misconceptions. Unlike most of us, he decided to do something about this realization. He proceeded to deliberately get himself fined for not wearing a mask, which gained him entry into the German court system. He intends to base his entire case on the anti-scientific methods of virology, specifically, the lack of controls. 11/10/22

https://drtomcowan.com/blogs/podcasts/56-marvin-haberland

Five Simple Questions For Virologists 10/14/22

https://drtomcowan.com/blogs/blog/five-simple-questions-for-virologists

Dr Cowan WHAT THE WORLD WOULD LOOK LIKE WITHOUT VIRUSES- WEBINAR 9/7/22

https://www.bitchute.com/video/cyTX5zHU7zDX/

WHAT THE WORLD WOULD LOOK LIKE IF EVERYONE KNEW VIRUSES DIDN'T EXIST- PART 2- 9/15/22

https://www.bitchute.com/video/ql8rbYpajavd/

Drs. Kaufman, Cowan and Corbett in an amazingly important and interesting discussion on: alternative medicine, the search for a virus, Covid Challenge, and the entire Medical Industrial Complex.9/28/22

https://www.bitchute.com/video/ZVcJcSZX1ni1/

Report 284 | Dr. Tom Cowan Exposes Virus/Infection Fallacies, Describes True Health 5/16/22

https://rumble.com/v142rp1-report-284-dr.-tom-cowan-exposes-virusinfection-fallacies-describes-true-he.html 

DR. TOM COWAN W JON RAPPOPORT SARS-COV-2 HAS NEVER BEEN ISOLATED, IS ONLY AN IMAGINARY OR THEORETICA 1/5/22

Ben Greenfield Fitness Why there's no such thing as a “pathogenic virus” 3/9/22

https://bengreenfieldfitness.com/podcast/tom-cowan-podcast/ 

DR. TOM COWAN AND CLIVE DE CARLE INTERVIEW Proposes a scientific experiment with virologists to prove once and for all viruses.6/22/22

https://www.bitchute.com/video/1xW7NfOXOoIs/

A brief message from Dr Cowan 12/30/20

https://www.youtube.com/watch?v=QIKFWiorbjo 

https://www.bitchute.com/video/fJRvQzmvCEPx 

Q&A Dr Cowan Detoxification Excretions Removing surgical metal from the body What causes skin cancer? Detoxing the skin 3/9/22

https://www.youtube.com/watch?v=juUUAvhtP9I 

Q&A Dr Cowan 48:30 talk about diabetes 2/16/22

https://www.youtube.com/watch?v=5Sj1wbSAqRU

Q&A Dr Cowan My Opinion on Legal Strategies Being Used / What Antibodies Mean 2/18/22

https://www.youtube.com/watch?v=tpAIbGi9s1I 

THE THIRD AND FINAL PILLAR OF VIROLOGY: THE GENOME - WEBINAR 1/29/22

https://www.bitchute.com/video/KNPMjomgGoKV/ 

VACCINES REVEALED [EPISODE 6] - DR. THOMAS COWAN ON VIRUSES AND COVID19 1/21/22

https://www.bitchute.com/video/jN2mvHCNvAgb 

O MY CRON - THE MYTH OF THE OMICRON  12/17/21

https://www.bitchute.com/video/dklnmNF2ZwCN 

Ep. 127: How Do We Know A New Virus Exists? Loree Bishoff Beginning over 150 years ago, scientists doing disease experiments couldn’t find the bacteria causing a certain illness. So they hypothesized that there must be something smaller than bacteria & labeled it a virus.  4/28/21

https://www.youtube.com/watch?v=iO1fVDW0-K4 

DO THE PICTURES ON THE ELECTRON MICROSCOPE PROVE THAT SARS-COV-2 EXISTS? 2/11/22

https://www.bitchute.com/video/j6Ddz8LMwHXw/ 

Live Q&A on YouTube 2/9/22

https://www.youtube.com/watch?v=LdTUx7sP0A8 

THE THIRD AND FINAL PILLAR OF VIROLOGY: THE GENOME - WEBINAR 2/12/22

https://www.bitchute.com/video/j6Ddz8LMwHXw/ 

(Dr. Tom Cowan & Dr. Jessica Rose | Rethinking Everything You Thought You Knew) 10/1/21

https://odysee.com/@therippleeffectpodcast:d/The-Ripple-Effect-Podcast--355:3 

There are no false positive or false negatives, the tests have no meaning

https://i.postimg.cc/Dz2z9k9m/No-false-positive-or-false-negative.jpg 

The idea of a virus is a misconception 2/13/21

https://www.facebook.com/bob.incognitto.35/posts/118122836896072?notif_id=1613177898244812&notif_t=close_friend_activity&ref=notif 

MERRITT MEDICAL HOUR WITH DR. TOM COWAN 2/5/22

https://www.bitchute.com/video/5BRFAGdFDtZ3/ 

Contagion Myth & Unconventional Ways to Treat Viruses

https://youtu.be/KGIzWjjkpNk 

Why Did Amazon Ban Our Book? with Sally Morell Fallon

https://www.youtube.com/watch?v=1JsJ5PWweZY&feature=youtu.be 

Do Germs Actually Make You Sick?  Dr. Cowan MD 8/31/20

https://www.youtube.com/watch?v=0V5QJVuHaC4&feature=youtu.be 

The 'Test Everybody' Strategy has NO Scientific Validity Whatsoever 11/10/20

https://www.youtube.com/watch?v=2mNhiNry8_Q&feature=youtu.be 

Health Freedom: Discerning Truth 10/25/20

http://www.westonaprice.org/podcast/health-freedom-discerning-truth/

Dr. Thomas Cowan Interview - From Germ Theory to Covid-19 - The Social Critic

https://lbry.tv/@Truth_will_set_You_Free:0/Dr.-Thomas-Cowan-Interview---Medical-Myths---From-Germ-Theory-to-Covid-19:7

The Contagion Myth w Tom Cowan, MD with Alfa Vedic 11/8/20

https://alfavedic.com/alfacast-episode/the-contagion-myth-tom-cowan-md/ 

Coronavirus Fear, Germ Theory, Exosomes, and Resiliency  Thomas Cowdan, MD, & Sayer Ji

https://regenerateproject.com/coronavirus-fear-germ-theory-exosomes-and-resiliency-thomas-cowdan-md-and-sayer-ji/

Dr Thomas Cowan interview on Infectious Myth

https://infectiousmyth.podbean.com/e/the-infectious-myth-thomas-cowan-on-covid-19-and-germ-theory/

The Fallacies of the Germ Theory with Dr. Thomas Cowan

https://www.youtube.com/watch?v=Drc9eRN6p_Y&feature=youtu.be

The Contagion Myth book with my esteemed colleague, Dr. Tom Cowan 8/14/20

https://nourishingtraditions.com/the-contagion-myth/

How Vaccines Cause Chronic Immune Dysregulation. Dr Thomas Cowan

https://www.forbiddendoctor.com/wp-content/uploads/2017/12/Vaccinations-with-Dr.-Thomas-Cowan-1.pdf 

Dr Thomas Cowan Ping Pong Virus & Bacteria Biograde Poisons - Hills

https://www.youtube.com/watch?v=Y34sBsoCMHM 

CV19 is just smoke and mirrors Dr. Cowan

https://www.youtube.com/watch?v=uUgx8TPHMos&feature=youtu.be

Dr. Thomas Cowan Covid19 fails Koch's postulates

https://www.youtube.com/watch?v=m3LgrcDAlJs

Is Germ Theory Wrong? An interview with Dr. Cowan

https://www.youtube.com/watch?v=0zhKxSlx0Gs

TMT Roundtable 3: Dr. Cowan & Filmmaker Marcy Cravat Explore Facts vs Viral Fiction

https://www.youtube.com/watch?v=goXVb5CrpbU&feature=youtu.be 

Solving the Woohan 5G Mexican Beer Virus Mystery With Dr. Thomas Cowan

https://www.youtube.com/watch?v=f84lS19jqeg&feature=youtu.be 

Dr Cowan on the coronavirus

https://www.youtube.com/watch?v=fQ1bAlutAx8 

The RSB Show 5-11-20 - Queen quarantine, Dr. Thomas Cowan, Electric universe, 5G

https://www.youtube.com/watch?v=ol4bcVse57c&t=2011s 

RTB | Dr Tom Cowan | SARS-CoV-2 has NOT been Isolated 2/14/21

https://www.podchaser.com/podcasts/raising-the-bar-with-john-coop-1290346/episodes/rtb-dr-tom-cowan-sars-cov-2-ha-84666096 

Dr. Mercola Interviews Dr. Thomas Cowan on How Vaccines Are Changing the Nature of Childhood Illness

https://www.youtube.com/watch?v=7ZsOe7x4KsM&app=desktop 

SALLY FALLON MORELL Weston A Price on book with Dr Cowan 8/28/20

https://www.bitchute.com/video/tzPNCmFKXrhh/ 

Now More Than Ever, Detoxification Is Crucial for Health – Dr Tom Cowan

https://drtomcowan.com/now-more-than-ever-detoxification-is-crucial-for-health/

Detoxify – Dr Tom Cowan

https://drtomcowan.com/products/detoxify/

Conversations with Dr. Cowan & Friends | Ep:5 Mike Benziger 9/29/20

https://www.youtube.com/watch?v=e2Dhu1nZ-tk&feature=youtu.be 

Conversations With Dr. Cowan & Friends | Ep4: Christen Brown & Ken Guoin 11/10/20

https://www.youtube.com/watch?v=DPKCLuXSi_Q 

Conversations With Dr. Cowan & Friends | Ep6: Gerald Pollock 11/10/20

https://www.youtube.com/watch?v=KGIzWjjkpNk 

Conversations with Dr. Cowan & Friends- Ep:9- Carrigan Curtis 11/10/20

https://www.youtube.com/watch?v=FOOtz16Fiv8&feature=youtu.be 

The true causes of disease--poisons (including EMF poisons) and nutritional deficiencies (including deficiencies of oxygen in our drinking water). The germ theory of medicine does not fit with the scientific facts and needs a rapid burial.

https://www.wisetraditions.org/tom-cowan 

In this interview, we cover many subjects having to do with circulation, Covid, glyphosate and the role of vitamin D in health and illness. 10/17/20

https://youtu.be/WQ675jLt19M 

Covid vaccine box

https://i.postimg.cc/cCGNkMQ7/covid-box.jpg 

How they sell that the vaccine works

https://i.postimg.cc/MppJLGjL/How-the-plans-for-vaccine-will-go.jpg 

Conversations with Dr. Cowan and Friends: The special connection with water! - Veda Austin

https://www.bitchute.com/video/WidMJTGIVyHO/ 

The Secret Intelligence of Water with Dr Cowan

https://www.vedaaustin.com/ 

The healing effects of sound waves - Conversations with Dr. Cowan and Ross Barrable 1/7/21

https://degroenegeus.wordpress.com/2021/01/08/conversations-with-dr-cowan-and-friends-episode-14-ross-barrable/ 

Dr Cowan interview with Tiamara Williams

https://www.youtube.com/watch?v=3bjOH31ogJo 

Dr Cowan on exosomes 3/13/21

https://m.facebook.com/story.php?story_fbid=131974102177612&id=100060950672339&notif_t=group_r2j_approved&notif_id=1615598556940219&ref=m_notif.

Conversations With Dr. Cowan & Friends Episode 22 - Chistopher Gardner 4/6/21

https://lbry.tv/@Truth_will_set_You_Free:0/Conversations-with-Dr.-Cowan---Friends_-Ep-22---Christopher-Gardner:b 

CONVERSATIONS WITH DR. COWAN & FRIENDS| EP 24: LESLIE MANOOKIAN 4/16/21

https://www.bitchute.com/video/Tub5Z2eOFw61/ 

NEW Mutations of the "Virus" Found! What does that REALLY Mean? 1/26/21

https://rumble.com/vda58t-new-mutations-of-the-virus-found-what-does-that-really-mean.html 

A Great Warrior Standing in the Truth - Dr. Tom Cowan at A Warrior Calls 5/6/21

https://lbry.tv/@Truth_will_set_You_Free:0/A-Great-Warrior-Standing-in-the-Truth-Dr.-Tom-Cowan-at-A-Warrior-Calls:8 

https://www.bitchute.com/video/rWUZQqPyxPTD/ 

DR TOM COWAN CANNOT FIND PROOF OF ISOLATION OF COVID-19 5/6/21

https://www.bitchute.com/video/Z7e1WLoOctZ2/ 

DR TOM COWAN - ANALYSIS OF ISOLATION OF THE COVID19 VIRUS (SARS-COV-2) IN AUSTRALIA 5/6/21

https://www.bitchute.com/video/BFX5TD4VDTti/ 

Dr Jason Loken - In this episode I sit down with Dr. Thomas Cowan who is a veteran in the alternative medicine arena. Today we talk about viruses and exosomes, the role that electricity plays in health and disease, a specific form of water that may decrease your risk of cancers and a deep dive into the roots of all disease. 5/7/21

https://www.youtube.com/watch?v=B1gfUwkJuaw 

Simple Strategies To Help Protect You And Your Family From Harm (In A Toxic World) 5/21/21

https://www.youtube.com/watch?v=skJ3td3cREI

Simple Strategies To Help Protect You And Your Family From Harm ( In A Toxic World) Webinar 5/21/21

https://www.bitchute.com/video/q0QUvtr1kBJh/ 

New Findings On The Spike Protein Toxin- Tom Cowan Live Webinar 6/7/21

https://www.bitchute.com/video/3vL74CEJL1W6/ 

COVID-19 Myths Dr Cowan 6/7/21

https://drtomcowan.com/covid-19-myths 

ZOOM WEBINAR FROM 6/11/21: DISCUSSION ON THE STUDY: ‘VIRUS’ IS IDENTICAL TO NORMAL CELL ‘STRUCTURES’

https://www.bitchute.com/video/IptvuaxgYKuY/ 

SubscribeStar Q&A June 15th,

https://www.dropbox.com/s/4finox6ze69v7de/SubscribeStar%20Q%26A%20June%2015th%2C%202021.mp4?dl=0&fbclid=IwAR0AOR9ypLJvvCOUizzztrl9hL9fHko5T8zqD1c3miPSXtwwfnX8SNTEKds 

Featured on Paul Chek's Podcast "Living 4D." "The Dark Side Of Medicine", we unravel the myths about modern medicine and get to the real truths. Start at 12 min mark 6/23/21

https://www.youtube.com/watch?v=swNtI2JwtJc

Heart Webinar 6/30/21

https://www.youtube.com/watch?v=EFPMQzASDzQ 

DR. ANDY KAUFMAN | EPISODE 29 | CONVERSATIONS WITH DR. COWAN & FRIENDS 6/30/21

https://www.bitchute.com/video/jQRO0iGOwg6M/ 

Dr. Tom Cowan Live Webinar: Covid- 19 Myths Preview + Q&A Session Topics Included Covid 19 Myths 2 Preview Ivermectin & Covid Patients -Rheumatoid Arthritis -Parasites -Varicose veins -STD's-Do energy frequencies have an influence on humans… 7/19/21

https://www.bitchute.com/video/Wa1b6XPcKqxx/ 

NOW THAT WE KNOW THERE ARE NO PATHOGENIC VIRUSES, WHY DO WE GET SICK?

https://www.bitchute.com/video/8d2oRSKuzqT0/

Today’s podcast is a fascinating interview with Dr. James DeMeo, the world’s foremost authority on the work of 20th Century physician and psychoanalyst Wilhelm Reich. 7/31/21

https://www.bitchute.com/video/DtF0otI9HCis/ 

Live with Dr Thomas Cowan 8/13/21

https://rumble.com/vkyyj9-episode-16.html 

Koch's Postulates- Friday 8/13 Webinar

https://www.youtube.com/watch?v=G-8J6mrdz1U 

Dr. Tom Cowan and Dr. Andrew Kaufman on Virology and the Stefan Lanka Control Experiment 8/13/21

https://www.bitchute.com/video/MXZUabOxTyMi/ 

Contagion Myth -Session 1 Tom Cowan 8/13/21

https://www.youtube.com/watch?v=T_soWxxZtCw 

WHAT DOES A MEDICAL DIAGNOSIS REALLY MEAN? WEBINAR 8/20/21

https://www.bitchute.com/video/V6qa4GwGNe37/ 

ANDRI PEETSO | EPISODE 34 | CONVERSATIONS WITH DR. COWAN & FRIENDS 8/20/21

https://www.bitchute.com/video/iHt7y6y6g4wn/ 

Alessio Angeleri, an Italian researcher, who uses his background in chemical and electrical engineering to look deeply into the question of how physical matter is created. 8/27/21

https://www.youtube.com/watch?v=yVBSNe8Ss4M 

CHICKENPOX LIVE WEBINAR 8/30/21

https://www.bitchute.com/video/koT9yJoVz8vt/ 

PHASE 2 OF STEFAN LANKA'S EXPERIMENTS 9/27/21

https://www.bitchute.com/video/FXV7LXXP1Rfe/ 

Dr. Tom Cowan is co-hosting the True Healing Conference with Dr. Andrew Kaufman.The pharmaceutical cartels make money by keeping us sick, treating 'symptoms' with toxic meds that make more 'symptoms' to treat. Dr. Cowan considers the root causes of illness and how to overcome them. This is information the pharmaceutical cartels don't want you to know. 10/12/21

https://rumble.com/vnd26k-red-pill-interview-dr.-tom-cowan.html

TRUE HEALING CONFERENCE PREVIEW WEBINAR Dr. Tom Cowan 10/12/21

https://www.bitchute.com/video/5mYNw9o6l9G3/

Germ Theory is nonsense: no virus has ever caused disease 10/22/21

https://odysee.com/@jermwarfare:2/tom-cowan:7 

In this webinar, I discussed Covid-19 tests: Dr Tom Cowan 11/9/21

https://www.bitchute.com/video/8d2oRSKuzqT0/ 

Dr. Thomas Cowan | Covid-19: FACT or FAKE? | Germ Theory & Modern Medicine's BIGGEST BLUNDERS 11/9/21

https://rokfin.com/stream/10486/Dr-Thomas-Cowan--Covid19-FACT-or-FAKE--Germ-Theory---Modern-Medicines-BIGGEST-BLUNDERS 

DR. THOMAS COWAN ON FIRE UNDERSTANDING THE GAME 11/10/21

https://www.bitchute.com/video/ROeJ7isIyain/ 

FRIDAY 11/5/21 WEBINAR & Q&A Dr. Tom Cowan

https://www.bitchute.com/video/8d2oRSKuzqT0/ 

NOW THAT WE KNOW THERE ARE NO PATHOGENIC VIRUSES, WHY DO WE GET SICK?

https://www.bitchute.com/video/8d2oRSKuzqT0/ 

Breaking the Spell

https://docs.google.com/document/d/e/2PACX-1vSd_gShbnCMV3BaJWgI4Nj4jS2ZBgZKcPNvk-spv7Ri5V935VWTEXdcOar4HJ1Y-s2o-ssCY38FFZcl/pub 

Dr Cowan on Lyme disease

https://www.bitchute.com/video/vJoVcxu3x3dr/ 

Q&A Dr Cowan Starts at 14:34 Gout How to cure Lyme's Disease Remineralizing teeth How to heal pulled muscles How to treat a sinus infection Vitamin D Type 1 Diabetes 3/17/22

https://www.youtube.com/watch?v=fP_5WEBQ26k 

Dr Cowan LIVE Q+A WEBINAR FROM MAY 18TH, 2022 The problem with treating "diagnoses" What happens when the body expresses headache symptoms? Is it okay to use Shilajit-Mumijo and Marine Plasma Drinkable Sea Water together? What about ticks and Lyme disease? Discussing published scientific studies on Lyme disease 5/20/22

https://www.bitchute.com/video/uGbIzsEwmMue/ 

In this webinar I discussed the Omicron variant and why the new variants and viruses never start from middle aged women from Brooklyn eating toads. 12/8/21

https://www.bitchute.com/video/PpKonZL2WmAg/ 

The Ripple Effect Podcast #355 (Dr. Tom Cowan & Dr. Jessica Rose | Rethinking Everything You Thought You Knew) 12/8/21

https://odysee.com/@therippleeffectpodcast:d/The-Ripple-Effect-Podcast--355:3?r=3Ev51nP6sZxhVosGu4nTiotfQjstF1Kd 

Freedom Talk 5 - Andy, Tom, Stefan, Dean 12/8/21

https://odysee.com/@DeansDanes:1/Freedom-Talk-5:b 

Dr Cowan MY SECOND COMPLIANCE ATTEMPT - WEBINAR 3/18/22

https://www.bitchute.com/video/g5tNopsEvvIc/ 

In the first half of the webinar, I previewed clips from an episode from The Viral Delusion series. 3/23/22

https://www.bitchute.com/video/BvkrVV8YFLIw/ 

Webinar: Lab Created Viruses: Smoking Guns or Bad Science? 3/26/22

https://www.subscribestar.com/posts/567641 

I also held a Q&A session. Topics included: Childhood eczema/asthma connection Unmineralized reverse osmosis water- is it safe? Getting off thyroid medication Best hydrogen device for water/breathing Turpentine for eustachian tubes Shingles Detoxing heavy metals Getting off immunosuppressants for an organ transplant Treatment for ALS Solutions for lack of sun 4/15/22

https://www.bitchute.com/video/69jPy847JLiP/ 

Q&A Topics Included: If you move to a different house an hour away, and now the entire family's getting sick when nothing else changed in our lives, what could be making us sick? Epstein-Barre Virus Are strokes related to antiphospholipid syndrome? Why do we get inflammation and clots in our blood? The best water to drink The benefits of taking Strophanthus Alternatives to Vitamin D Is it healthy to donate blood? Leprosy Can trees and animals get viruses? Cod liver oil 4/13/22

https://www.bitchute.com/video/fuE4YBTGuPld/ 

Response to Fuellmich: Fact or Fiction? 4/21/22

https://www.youtube.com/watch?v=dI6kzIGogSM 

Tom Cowan live webinar 4/27 I discussed if the Phylogenetic Tree Proves the Existence of SARS-COV-2. Tune in to find out. I also held a Q&A session; topics include: My rebuttals to the anti-vax community Koch's Postulates Changes in smell Botulism Vaccines & vaccines in children My opinion on German New Medicine 5/3/22

https://www.bitchute.com/video/d1wk1klheZiK/ 

Conversation with the world famous MD, author and researcher Tom Cowan. Tom is one of the leaders in the evidence-based medicine movement. Through his active educational work, he was able to help thousands of people around the world to independently check the actions of scientists, distinguish truth from fiction in science and wake up to the real biology, which is inherently free from fear.

https://odysee.com/@katie.su:7/kateinterviewstomcowan:0 

Dr Cowan discussed and reviewed some statements from Dr. Judy Mikovits regarding what she has been saying publicly about SARS-COV-2.  5/4/22

https://www.bitchute.com/video/iqrlLCOkbE7O/ 

Q&A Topics include: What causes cellulitis? Viruses, bacteria, and parasites Terrain Theory & bioweapons Distemper in dogs Analemma water wand Emotional distress Stitching wounds 5/11/22

https://www.bitchute.com/video/ZM90VKN3n5hw/ 

Dr. Grayson left modern medicine after finding out that modern medical practices did not improve people’s health and are oftentimes harmful. 5/11/22

https://drtomcowan.com/blogs/podcasts/48-dr-grayson-dart 

Dr Cowan Q&A Topics include: Turmeric, planting Fruit trees, Blood pressure parameters Water filters Showerheads Structured water Urine therapy The placebo effect Cysts Allergy shots Dehydration SaunaSpace Infrared Saunas 5/16/22

https://www.bitchute.com/video/Aerp8Ivj4oal/ 

THERE IS NO VIRUS: PSEUDOSCIENCE & THE MADNESS OF MODERN VIROLOGY -- COWAN & WALLACH 5/23/22

https://rumble.com/v1373lf-there-is-no-virus-pseudoscience-and-the-madness-of-modern-virology-cowan-an.html 

Ep 143: Natural Detoxification, Viral Theory And The New Biology Of Water With Dr. Tom Cowan 5/18/22

https://www.youtube.com/watch?v=YIxHhFDKbXc 

Dr Cowan LIVE Q+A WEBINAR FROM MAY 20TH, 2022Tetanus virus and shots Monkeypox Pumpkin challenge 2 with smallpox photos Women having trouble with menopause Is it safe to be intimate with vaccinated people? Postpartum depression… 5/22/22

https://www.bitchute.com/video/6Jh9I9rNmQr4/ 

Dr Cowan LIVE Q+A WEBINAR FROM MAY 27TH Topics include: Lichen Sclerosis Is Juvenile Dermatomyositis caused by 5G radiation poisoning? "Red meat allergy" that is supposedly caused by lone star tick bites Megadoses of vitamin C Is it true that one should avoid salt when diagnosed with congestive heart failure? 5/27/22

https://www.bitchute.com/video/Tet6q0OHSArg/ 

Dr. Cowan  Q+A topics included: New biology perspective behind thyroid issues Copper supplementation EMF meters Natural ways to treat cataracts Is there a connection between heart disease and gum disease? Any clues on Dupuytren's and how to heal it? 6/1/22

https://www.bitchute.com/video/ivHZXPWKbXr2/ 

Dr Tom Cowan  hosted a Q+A. Topics included: - What is the function of pubic hair and should one shave it or not? - How I make bone broth - Do appendices rupture and what can you do about that? - How do you go without drugs for ankylotic spondylitis? - The importance of making life more of a human process - Psychotropic effects of Strophanthus 6/10/22

https://www.bitchute.com/video/mPJvBeFv4XJb/ 

Tom Cowan hosted a live webinar on July 1st. I started by discussing some recent information regarding COVID-19 and other virus developments. Then I discussed how science studies life. 7/2/22

https://www.bitchute.com/video/fo10Mt8PfwXb/ 

Tom Cowan Q&A session; topics included: Thoughts on spirulina and chlorella Why do antibiotics work? Thoughts on "pink eye" (conjunctivitis) What about post-antibiotic diarrhea? Should someone take probiotics? Thoughts on hormone replacements Menopause What does a persistent cough mean after you are sick? What about beta-blockers? 7/6/22

https://www.bitchute.com/video/o1vXS5JmUcq2/ 

In this webinar, I spoke about whether using a puzzle is a good analogy for metagenomic sequencing and the problems with doing metagenomic sequencing. Then I talked about the basic structures of a nerve and where neurological disease comes from. I also read a case about someone diagnosed with a neurological disease who recovered. Lastly, I talked about some possible recovery treatments for neurological diseases. 7/12/22

https://www.bitchute.com/video/PwkTdPaj6qpR/ 

Dr. Tom Cowan - Leading The Charge in to a New Age of Medicine 7/14/22

https://humanley.podbean.com/e/episode-58-dr-tom-cowan-a-modern-day-hero/

In this webinar, Tom Cowan covered the following topics: -Isolating and purifying my cat Pumpkin from the garden -Showing a video sent to us from a customer who has been using the AquaCure device 8/3/22

https://www.bitchute.com/video/A3HtEDYsWTC9/ 

In this webinar, Tom Cowan discussed Alzheimer's and practical suggestions on how to heal.  8/17/22

https://www.bitchute.com/video/Tz9IQWOJjAUo/ 

Dr. Thomas Cowan - Everything You Need to Know About PCR 'Tests' 8/25/22

https://odysee.com/@dharmabear:2/Dr-Thomas-Cowan-PCR-Tests-August-24th-2022:b 

Dr Tom Cowan ALL ABOUT SMALLPOX- WEBINAR 9/26/22

https://www.bitchute.com/video/tEeH5eFY4SpM/ 

In this webinar, Dr Tom Cowan discussed heart attacks- what they are, what they are not, and what causes them. I also discuss all of the things that generate a healthy life, which generate a healthy electromagnetic field in your heart, which organizes, and conducts, all the organs into a coherent whole. 9/29/22

https://www.bitchute.com/video/0GpZxzSbkIgi/

Heart not be a pump Dr Cowan 2 parts

https://youtu.be/ZFUomLdn9aQ

https://documentcloud.adobe.com/link/review?uri=urn%3Aaaid%3Ascds%3AUS%3Ababb7a09-7aaa-4b96-9107-8b205d1b2262 

The Heart is not a pump. Dr. Thomas Cowan Part 2

https://www.youtube.com/watch?v=kUCBEKO3IJc&feature=youtu.be\

Dr. Thomas Cowan - How To Heal Your Heart Naturally Without Drugs!

https://www.youtube.com/watch?v=Qh0dJfxXTVE

Dr. Tom Cowan - What Causes Heart Attacks 2/16/21

https://drtomcowan.com/what-causes-heart-attacks/ 

Q&A Heart attacks WITH A SHORT STORY ON HOW TO GET AROUND MANDATES AND FINES 2/25/22

https://www.bitchute.com/video/gLFmJOi1DZ3b/

Dr Thomas Cowan & Our Cosmic Hearts - Rogue Ways 8/27/20

https://www.youtube.com/watch?feature=youtu.be&v=rxSYtfI92yQ&app=desktop

Human Heart, Cosmic Heart with Guest Dr. Thomas Cowan

https://www.youtube.com/watch?v=ha0-aJVMuYk&feature=youtu.be

Q&A Dr Cowan - blood pressure talk 3/7/22

https://www.youtube.com/watch?v=UEyDP_Q0iYY

Dr Cowan Live Q+A on YouTube - Atrial Fib 3/2/22

https://www.youtube.com/watch?v=clM0NOiXnCo

Episode 8 of Wellness = Water series: "Into the Heart of the Matter" 12/30/20

https://www.youtube.com/watch?v=bYaklzMf5TI

My thoughts on "debating" the leaders of the health freedom community Possible solutions for tinnitus and vertigo ‘Ebola virus’ in Uganda GMO seeds My thoughts on CBD Can the mRNA or a spike protein be isolated? Or are they phantoms as well? Recommendations for hemorrhoids In regards to Gerald Pollack’s talks, shouldn’t the body, in its infinite wisdom, know exactly how to structure the water that we drink? 10/10/22

https://www.bitchute.com/video/ZO2LCazfVrmm/ 

DR. TOM COWAN INTERVIEW WITH PATRICK TIMPONE 11/1/22

https://www.bitchute.com/video/0h8MDpyLIenY

Dr Tom Cowan LIVE WEBINAR FROM FRIDAY, NOVEMBER 4TH 11/7/22

https://www.bitchute.com/video/jH7Ti1J7upBE/ 

Mike Stone goes through exactly they’re doing in these gain of fiction experiments.11/18/22

https://drtomcowan.com/blogs/podcasts/57-mike-stone

Weston A Price

Wise Traditions Podcast links

https://www.westonaprice.org/podcast/ 

She shares her understanding of the difference between germ theory and terrain theory and contagion and resonance, the latter being how we communicate with one another on a quantum level. She dives into the science of it all and explains the pleomorphic cycle of healing. Along the way, Marcy offers insights and she celebrates the intrinsic wisdom of our bodies to bring us back to balance and health. 6/7/22

https://www.westonaprice.org/podcast/germ-theory-v-natural-law/ 

Covid: There Is No Virus with Dr. Tom Cowan 10/19/21

https://www.westonaprice.org/podcast/covid-there-is-no-virus/ 

Understanding Our Current Health Crisis Dr Tom Cowan

https://www.westonaprice.org/health-topics/understanding-our-current-health-crisis/ 

COVID-19: Pursuing Truth to Protect Our Liberties

https://www.westonaprice.org/health-topics/covid-19-pursuing-truth-to-protect-our-liberties/ 

Is Coronavirus Contagious?

https://www.westonaprice.org/health-topics/is-coronavirus-contagious/ 

Dr. Sam & Mark Bailey 

Odysse channel

https://odysee.com/@drsambailey:c 

Mark Bailey A farewell to virology 9/26/22

https://21stcenturywire.com/2022/09/25/episode-435-a-farewell-to-virology-with-guest-dr-mark-bailey

They are both medical doctors who chose to no longer be medical doctors, thanks to the medical industry. Instead, they upgraded their outlook and chose to research – and promote – better ideas surrounding medicine and health. 11/2/22

https://odysee.com/@jermwarfare:2/The-Baileys:8 

Dr Mark Bailey on with Charles Kovess, and Dr Stephen Frost 10/27/22

https://rumble.com/v1pq6ad-dr-mark-bailey.html

Dr. Mark Bailey’s “virus debate” with Dr. Zachary Ardern, evolutionary biologist 6/15/22

https://www.fluoridefreepeel.ca/dr-mark-baileys-virus-debate-with-dr-zachary-ardern-evolutionary-biologist 

Sneak Peak: "The Viral Delusion" 3/20/22

https://odysee.com/@drsambailey:c/sneak-peak-the-viral-delusion:f 

The Drs Bailey take on the hilarious Steve Falconer - the man behind Spacebusters.

https://odysee.com/@drsambailey:c/Baileys-vs-Spacebusters:5

Gain of Function or Science Fiction? with Dr. Sam Bailey 8/8/22

https://unitelive.earth/the-way-forward/health-freedom-for-humanity?recording_id=1272

Fact-check: New Zealand can’t find the “SARS-CoV-2 virus” 2/12/22

https://drsambailey.com/covid-19/fact-check-new-zealand-cant-find-the-sars-cov-2-virus 

Dr Sam Bailey is a medical doctor from New Zealand, who over the last 2 years, has been speaking out publicly on major issues plaguing science and medicine. One of the major issues that she has voiced her concerns over, is the lack of scientific evidence proving that germs cause disease. 2/24/22

https://www.humanley.com/blog/episode42 

Dr Mark Bailey Dismantles Germ Theory - The Humanley Podcast 3/20/22

https://odysee.com/@lancewdetrick:b/IA---Dr-Mark-Bailey-Dismantles-Germ-Theory---The-Humanley-Podcast:8 

“Monkeypox” – who could have seen it coming? 5/31/22