Name:                                                                         Block:                 

IB Protein Synthesis Animations

Transcription

Use the mRNA Synthesis Animation to answer the following questions.

1. Where does transcription begin?

2. What synthesizes (creates) the complementary mRNA molecule?

3. How many strands is the mRNA?

4. What is the template DNA strand called?

5. In what direction does synthesis take place?

6. When does transcription stop?

Translation

Use the Translation animation to answer the following questions.

1. To what part of the ribosome does the mRNA bind?

2. To where do each tRNA molecule bind on the mRNA?

3. What is the purpose of the tRNA molecule?

4. What type of bond is formed between amino acids?

5. Describe the progression of the ribosome on the mRNA.

6. When does the process of translation stop?

Protein Synthesis

Use the Protein Synthesis animation from The Concord Consortium to answer the following questions.

1. Observe the full process of protein synthesis using the animation.
2. List the protein (sequence of amino acids) that is produced:

3. Click “Edit DNA” to change the DNA sequence to the following:

“ATGCCGGGCGGCGTTAGCTTGCTAATTCCCTTATAG”

4. List the protein (sequence of amino acids) that is produced:

5. What effect does the change in DNA code produce?

6. Create a diagram to represent all steps of protein synthesis