Name: Block:
IB Protein Synthesis Animations
Transcription
Use the mRNA Synthesis Animation to answer the following questions.
- Where does transcription begin?
- What synthesizes (creates) the complementary mRNA molecule?
- How many strands is the mRNA?
- What is the template DNA strand called?
- In what direction does synthesis take place?
- When does transcription stop?
Translation
Use the Translation animation to answer the following questions.
- To what part of the ribosome does the mRNA bind?
- To where do each tRNA molecule bind on the mRNA?
- What is the purpose of the tRNA molecule?
- What type of bond is formed between amino acids?
- Describe the progression of the ribosome on the mRNA.
- When does the process of translation stop?
Protein Synthesis
Use the Protein Synthesis animation from The Concord Consortium to answer the following questions.
- Observe the full process of protein synthesis using the animation.
- List the protein (sequence of amino acids) that is produced:
- Click “Edit DNA” to change the DNA sequence to the following:
“ATGCCGGGCGGCGTTAGCTTGCTAATTCCCTTATAG”
- List the protein (sequence of amino acids) that is produced:
- What effect does the change in DNA code produce?
- Create a diagram to represent all steps of protein synthesis