6/12/2013 (Stephen)
Restriction site analysis of vector component sequences was carried out using webcutter 2.0 (http://rna.lundberg.gu.se/cutter2/). Checked each sequence for BioBrick® standard sites (EcoRI, XbaI, SpeI, PstI), as well as sites used to linearize plasmids containing pAOX1 promoter for improved transformation efficiency (BstXI, PmeI, SacI).
6/22/2013 (Stephen)
Cleared RE sites in Vector #1 and Vector#2 according to vector design outline (Table 1). Inserted BioBrick prefix and suffix sequences, as well as several unique RE sites to be used in cloning procedures. Included below are the maps for both vectors (Fig 1).
6/24/2013 (Stephen)
HindIII and KpnI RE sites will be used to make the OriT/PARS1 component modular. Vector #1 did not have any HindIII sites, nor any KpnI sites. Vector 2 did not contain any KpnI sites, however three HindIII sites were present.
Replaced original WntrFrsh sequence with codon optimized version (http://www.idtdna.com/CodonOpt), with appropriate RE sites removed (Table 1).
Vector #1 | ||||
Component | RE | Site | Conversion | Amino Acid |
pGAP | BglII | 1772 | C1776T | - |
YeGFP | NcoI | 2442 | A2444T | P |
YeGFP | XbaI | 2490 | T2492C | S |
YeGFP | NdeI | 2505 | T2507C | H |
YeGFP | NcoI | 2966 | T2969C | H |
tAOX1 | BamHI | 3349 | G3350A | - |
Vector #2 | ||||
Component | RE | Site | Conversion | Amino Acid |
G418 | NsiI | 755 | A759C | A |
G418 | NsiI | 1021 | T1026C | H |
pAOX1 | BglII | 2536 | A2538G | - |
pAOX1 | NsiI | 3208 | T3213C | - |
WntrFrsh | NsiI | 3654 | C3657T | C |
WntrFrsh | BamHI | 4161 | T4161C | D |
WntrFrsh | NcoI | 4205 | C4206T | A |
WntrFrsh | NsiI | 4259 | A4263T | A |
G418R | HindIII | 1027 | G1029A | K |
pAOX1 | HindIII | 3407 | T3411C | - |
WntrFrsh | HindIII | 3864 | C3867T | S |
WntrFrsh Codon Opt | NdeI | 3520 | T3522C | H |
WntrFrsh Codon Opt | NsiI | 3654 | C3657T | C |
WntrFrsh Codon Opt | SpeI | 3711 | A3714T | L |
WntrFrsh Codon Opt | BglII | 4099 | A4101G | R |
WntrFrsh Codon Opt | BamHI | 4161 | T4164C | D |
WntrFrsh Codon Opt | NsiI | 4259 | A4263T | A |
Table 1. Restriction site removal for Vector 1 and Vector 2
Figure 1. iGEM 2013 Vector maps (not final, needs vector name change and inclusion of KpnI and HindIII sites)
6/3/2013 (Stephen)
Designed primers for backbone assembly and cloning primers for pGAP-OriT and pAOX-OriT (Table 2). For cloning primers, appropriate bases were added to improve restriction enzyme efficiency according to NEB. (https://www.neb.com/tools-and-resources/usage-guidelines/cleavage-close-to-the-end-of-dna-fragments)
Vector 1 | ||
Primer | Sequence | |
1F | CCCTCGAGACTAGTCTGCAGCCCACACACCATAGCTTCAA | |
1R | TAACTAATTACATGATATCG | |
2F | CGATATCATGTAATTAGTTA | |
2R | TTCCATTACTCCACATTTAA | |
3F | TTAAATGTGGAGTAATGGAA | |
3R | CAGATTGAGTGGATAAGTAA | |
4F | TTACTTATCCACTCAATCTG | |
4R | CTGCAGACTAGTCTCGAGGG | |
Vector 2 | ||
Primer | Sequence | |
1F | CACTCGAGACTAGTCTGCAGCCCACACACCATAGCTTCAA | |
1R | AGCCATTACGCTCGTCATCA | |
2F | TGATGACGAGCGTAATGGCT | |
2R | TGGTATCTTTATAGTCCTGT | |
3F | ACAGGACTATAAAGATACCA | |
3R | TCAGTTTTGGGCCATTTGGG | |
4F | CCCAAATGGCCCAAAACTGA | |
4R | GGAACAAACGTGTATAAAAA | |
5F | TTTTTATACACGTTTGTTCC | |
5R | CTGCAGACTAGTCTCGAGTG | |
α-secretion signal | ||
Primer | Sequence | Notes |
1F | AAAGATCTAAAAATGAGATTTCCTTCAA | 5' BglII |
1R | AAAGGATCCAGCTTCAGCCTCTCTTTTCT | 5' BamHI |
OriT/PARS1 | ||
Primer | Sequence | Notes |
1F | ATAAAGCTTCCGGCCAGCCTCGCAGAGCA | 5' HindIII |
1R | GGTAAGCTTTAGCTTCGACAATTAATATT | 5' HindIII |
OriT/PARS1 | ||
Primer | Sequence | Notes |
1F | ATAAAGCTTCCGGCCAGCCTCGCAGAGCA | 5' HindIII |
1R | GGTAAGCTTTAGCTTCGACAATTAATATT | 5' HindIII |
pGAP-OriT | ||
Primer | Sequence | Notes |
1F | ATCTAGAAGATTTTTTTTGTAGAAATG | 5' XbaI |
1R | AAAGATCTATAGTTGTTCAATTGATTGA | 5' BglII |
pAOX-OriT | ||
Primer | Sequence | Notes |
1F | ATCTAGAAGATTTAACATCCAAAGACG | 5' XbaI |
1R | AAAGATCTTCGTTTCGAATAATTAGTTG | 5' BglII |
Table 2. Primers to be used in backbone assembly and cloning of pGAP-OriT and pAOX-OriT.
07/15/2013 (Jake, Jen)
Rehydrated primers and vector components in nuclease free water.
Prepared PCR reactions according to recipe:
5X Buffer (10 µl)
dNTP (1.5 µl)
Primer F (1µl)
Primer R (1µl)
Template (1µl)
Phusion HF DNA polymerase (0.5 µl)
H2O (35 µl)
Ran thermocycler program (in cycler #1):
Template | Forward Primer | Reverse Primer |
2-1 | V2_1F | V2_1R |
2-2 | V2_2F | V2_2R |
2-3 | V2_3F | V2_3R |
2-4 | V2_4F | V2_4R |
2-5 | V2_5F | V2_5R |
1-1 | V1_1F | V1_1R |
1-3 | V1_3F | V1_3R |
1-4 | V1_4F | V1_4R |
pGAP | pGAPOriTF | pGAPOriTR |
OriTPARS1 | OriTPARS1F | OriTPARS1R |
AlphaSec | AlphaSecF | AlphaSecR |
98˚C 2’ - 1x
98˚C 10’’ - 30x
50˚C 30’’ - 30x
72˚C 45’’ - 30x
72˚C 7’ - 1x
4˚C hold
7/18/2013 (Stephen)
Preparing WtrFrsh part requires PCR amplification with BB prefix and suffix sequences. The WtrFrsh open reading frame spans two of the ordered vector strings (V2_4 and V2_5). Two PCR reactions must be performed to obtain WtrFrsh open reading frame with overlap. The first reaction will include V2_4R and WtrFrsh F primers. The second reaction will include primers V2_5F and WtrFrsh R primers.
PCR Reaction Setup (per reaction)
5X Phusion buffer 10 uL
dNTP 1.5 uL
Forward primer 1 uL
Reverse primer 1 uL
Template 1 uL
Phusion 0.5 uL
ddH2O 35 uL
PCR Program
98 C 02 min
98 C 10 sec
50 C 30 sec
72 C 45 sec
72 C 10 min
04 C hold
07/18/13 (Jake)
Agarose and 1% TAE gels were run to verify PCR products obtained on 7/15/13.
First PCR Run, 1st Gel, Bands 1-15
Top Wells (left to right)
ladder
2-1
2-2
2-3
2-4
2-5
1-1
1-3
1-4
Bottom Wells (left to right)
ladder
pGAP
OriTPARS1
AlphaSec
-empty-
PCSK1
PCSK2
-empty-
PCSK3
INS
First PCR Run, 2nd Gel, Bands 1-4
Reamplify
2-1
1-1
pGAP
Alpha
7/18/13 (Jen)
Rehydrated R and F pAOX-OriT primers for 30 minutes
PCR Reactions
Reaction | Template | Forward Primer | Reverse Primer |
1 | pAOX OriT 1 | B9 | pAOX R |
2 | pAOX OriT 2 | pAOX F | B10 |
PCR reaction for pAOX-OriT with internal and external primers
5X Phusion buffer 10 uL
dNTP 1.5 uL
Forward primer 1 uL
Reverse primer 1 uL
Template 1 uL
Phusion HF DNA Polymerase 0.5 uL
ddH2O 35 uL
PCR Program
98 C @ 2 min
98 C @ 10 sec
50 C @ 30 sec
72 C @ 45 sec (repeat last 3 steps 30 X)
72 C @ 10 min
04 C - hold, stored in vector freezer box. (labeled pot1 and pot2)
07/22/2013 (Stephen)
Reamplification of 2-1, 1-1, pGAP, Alpha
Template | Forward Primer | Reverse Primer |
2-1 | V2_1F (A01) | V2_1R (A02) |
1-1 | V1_1F (A11) | V1_1R (A12) |
pGAP | pGAPOriTF (B07) | pGAPOriTR (B08) |
Alpha | AlphaSecF (C01) | AlphaSecR (C02) |
PCR Program
98 C @ 2 min
98 C @ 10 sec
50 C @ 30 sec
72 C @ 45 sec (repeat last 3 steps 30 X)
72 C @ 10 min
04 C - hold
Gel Verification of PCR Products
5 uL sample, 5 uL Blue Dye
Ladder, 2-1, 1-1, pGAP, Alpha, blank, blank, blank
Ladder, WtrFrsh1, WtrFrsh2, pAOX-OriT1, pAOX-OriT2, blank, blank, blank
Ran gel 10 min @ 115V (not enough separation)
Ran gel 10 min @ 120V
Results:
All samples were positive except for pAOX-OriT1, pAOX-OriT2. Reamplify both of these on Thursday and gel verify.
7/22/13 (Jen)
PCR DNA Purification
Performed DNA purification of PCR products from 7/18/13. Followed protocol for PCR products listed in Illustra GFX PCR DNA and Gel Band Purification Kit (substituted warm ddH2O for elution buffer). Labeled and stored products in vector freezer box.
7/25/13 (Jake)
PCR Reactions for pAOX1 and pAOX2 were redone, as banding was inconclusive in the last gel.
Reaction | Template | Forward Primer | Reverse Primer |
1 | pAOX OriT 1 | B9 | pAOX1 R |
2 | pAOX OriT 2 | pAOX2 F | B10 |
3 | PCSK1 | PCSK1_1F | PCSK1_1R |
4 | PCSK2 | PCSK1_2F | PCSK1_2R |
PCR reaction for pAOX-OriT with internal and external primers
5X Phusion buffer 10 uL
dNTP 1.5 uL
Forward primer 1 uL
Reverse primer 1 uL
Template 1 uL
Phusion HF DNA Polymerase 0.5 uL
ddH2O 35 uL
PCR Program
98 C @ 2 min
98 C @ 10 sec
50 C @ 30 sec
72 C @ 45 sec (repeat last 3 steps 30 X)
72 C @ 10 min
07/25/2013
Quantification of column purified PCR amplified strings.
Results:
Sample | ng/uL |
2 2 | 6.9 |
2 3 | 13.5 |
2 4 | 7.3 |
2 5 | 4.6 |
1 3 | 4.5 |
1 4 | 5.7 |
OriTPARS1 | 3.8 |
Vector 1-1 | 63.3 |
Vector 2-1 | 76.3 |
pGAP-OriT | 44 |
WtrFrsh 1 | 21.3 |
WtrFrsh 2 | 17.3 |
alpha-sec signal | 72.1 |
Sub-optimal concentration of DNA in the following samples:
OriT-PARS1, 1-4, 1-3, 2-5, 2-4, 2-3, 2-2
Reamplify these strings and run 8x1 gel for verification.
Vector 1-1, Vector 2-1, pGAP-OriT, WtrFrsh1, WtrFrsh2, a-sec signal samples look good, storing in freezer box.
07/26/2013
Gel verification of OriT-PARS1, 1-4, 1-3, 2-5, 2-4, 2-3, 2-2
Gel setup:
Ladder, OriT-PARS1, 1-4, 1-3, 2-5, 2-4, 2-3, 2-2
20 min @ 120V
Results:
(GEL IMAGE IS IN IGEM2013 FOLDER ON NETWORK DRIVE)
Positive result for all samples.
Column purified samples from today’s gel verification. DNA must be quantified for each sample on 7/29/2013. WtrFrsh1 and WtrFrsh2 purity (260/230) was low. Attempt overlap with current samples, and re-amplify WtrFrsh1 and WtrFrsh2 if necessary.
7/29/13 (Jake)
Quantification of DNA using NanoDrop Spec:
Component | abs230 | abs260 | abs280 | ng/µL |
1-3 | .857 | .427 | .259 | 21.4 |
1-4 | .960 | .570 | .314 | 28.5 |
2-2 | .807 | .220 | .113 | 11.6 |
2-3 | .602 | .266 | .166 | 13.3 |
2-4 | 4.063 | .346 | .194 | 17.3 |
2-5 | 3.503 | .328 | .196 | 16.4 |
OriT-PARS1 | 2.087 | .623 | .338 | 31.2 |
08/01/2013
Overlap PCR of WtrFrsh1 WtrFrsh2 (Stephen)
5X Phusion buffer 10 uL
dNTP 1.5 uL
WtrFrsh-1 2 uL
WtrFrsh-2 4 uL
Phusion 0.5 uL
ddH2O 31 uL
Ran overlap PCR program 15 min. During 4oC pause, added 1 uL WtrFrsh F and 1 uL WtrFrsh R primers.
08/08/2013
Concentration of V1-5 determined through nanodrop:
V1:152.0 V2:20.6 V3:26.9 V4:33.0 V5:29.4
Gibson Assembly of V-1 through V-5
MasterMix - 3.5uL
V#2-5 1uL each
V#1 0.5uL
H2O 2uL
08/12/2013
Transformation of E. coli with Vector 2 Gibson Assembly (Stephen)
1. 10 uL of Vector 2 Gibson assembly from 8/8/2013 was added to 50 uL of chemically competent C2566 E. coli cells.
2. The above mixture was allowed to incubate on ice for 20 minutes.
3. Performed heat shock, 42oC for 30 seconds.
4. Returned to ice, let rest 1 minute.
5. Cells recovered in 1 mL LB, shaking for 1 hour at 37oC.
6. Spun cells down at 4000 rpm for 3 minutes. Poured off excess LB, resuspended cells in remaining LB.
7. Plated 100 uL of the resuspension on a G418 plate, as well as 50 uL of the resuspension on a separate G418 plate.
8. Plates were incubated overnight at 37oC.
08/12/2013 (Stephen)
Growth Check of Plates from 08/12/2013 (Stephen)
Neither plate showed growth. Redoing the DNA quantification and Gibson assembly.
Quantification of V2_1, V2_2, V2_3, V2_4, V2_5 (Stephen)
Sample ID | ng/ul | A260 | A280 | 260/280 | 260/230 | Cursor abs. | 340 raw |
V2_1 | 136.01 | 2.72 | 1.472 | 1.85 | 0.35 | 7.833 | 0.058 |
V2_2 | 19.35 | 0.387 | 0.209 | 1.86 | 0.26 | 1.511 | 0.048 |
V2_3 | 24.06 | 0.481 | 0.265 | 1.81 | 0.38 | 1.268 | 0.041 |
V2_4 | 29.59 | 0.592 | 0.33 | 1.79 | 0.08 | 7.194 | 0.029 |
V2_5 | 26.07 | 0.521 | 0.286 | 1.82 | 0.09 | 5.744 | 0.035 |
pAOX-OriT 1 | 986.14 | 19.723 | 12.521 | 1.58 | 0.91 | 21.635 | 0.076 |
pAOX-OriT 2 | 979.76 | 19.595 | 12.383 | 1.58 | 0.91 | 21.457 | 0.09 |
Gibson Assembly of Vector 2 (Stephen)
Made 30 ng/uL dilution of V2_1.
Created two separate gibson assembly reactions with same components:
1 uL V2_1 30 ng/uL dilution
1uL V2_2
1uL V2_3
1uL V2_4
1uL V2_5
1.5 uL ddH2O
3.5 uL Gibson Master Mix
Incubated 5 minutes in 37oC
Ran Gibson thermocycler program on both reactions.
5 min 37oC
60 min 50oC
Transformation of E.coli with Vector 2 Gibson Assembly (Stephen)
Combined two 10 uL Gibson assembly reaction products.
Added 20 uL of above mixture to 50 uL thawed chemically competent C2566 E. coli cells.
Incubated on ice for 20 min.
Heat shocked cells at 42oC for 30 sec.
Returned to ice for 1 min.
Recovered cells in 1 mL LB, shaking for 1 hr.
Plating:
Pelleted cells at 4000 rpm for 3 min. Resuspended pellet in 100 uL LB.
Plated 50 uL of culture on LB plate that had been coated with 25 uL of G418.
Plated 50 uL of culture on G418 plate (200 mg/mL)
pAOX-OriT 1 / pAOX-OriT 2 Overlap PCR (Stephen)
pAOX-OriT 1 - 2.49 pMols DNA
pAOX-OriT 2 - 2.63 pMols DNA
5X Phusion buffer 10 uL
dNTP 1.5 uL
pAOX-OriT 1 1 uL
pAOX-OriT 2 1 uL
Phusion 0.5 uL
ddH2O 34 uL
Added primers
B9, B10
Vector 2 Overlap PCR to Reduce Gibson Assembly Components (Stephen)
Two overlap PCR reactions were created.
Reaction 1 V2_1 and V2_5
5X Phusion buffer 10 uL
dNTP 1.5 uL
V2_1 1 uL
V2_5 1 uL
Phusion 0.5 uL
ddH2O 34 uL
Added primers:
V2_5F (A09) 1 uL
V2_1R (A02) 1 uL |
Reaction 2 V2_2 and V2_3
5X Phusion buffer 10 uL
dNTP 1.5 uL
V2_2 1 uL
V2_3 1 uL
Phusion 0.5 uL
ddH2O 34 uL
Added primers:
V2_2F (A03) V2_3R (A06) |
08/14/2013 (Stephen)
No growth on plates from 08/12/2013. Literature shows 30 ug/mL G418 media being optimal for E. coli growth. Prepared plates with 30 ug/mL G418.
In order to test media, the following plates were streaked:
LB - pUCBB
LB - pSRCK
30 ug/mL G418 - pUCBB
30 ug/mL G418 - pSRCK
200 ug/mL G418 - pUCBB
200 ug/mL G418 - pSRCK
Expected results:
Both LB plates should show growth. pSRCK has kanamycin resistance and should grow on the 30 ug/mL plate, but not on the 200 ug/mL plate. pUCBB has ampicillin resistance and should not grow on the 30 ug/mL or the 200 ug/mL plate.
Gel verification of pAOX-OriT Overlap and Vector 2 Gibson Preparation Overlap PCR (Stephen)
Gel setup:
Ladder, pAOX-OriT1, pAOX-OriT2, pAOX-OriT Overlap, V2_1_5, V2_2_3, V2_4, blank
Results:
pAOX-OriT Overlap appears to have been successful. The banding at approximately 1100 bp is consistent with the combination of pAOX-OriT1 (600 bp) and pAOX-OriT2 (566 bp). V2_1_5 shows banding at roughly 2 kb, consistent with the combination of V2_1 (1 kb) and V2_5 (933 bp). V2_2_3 banding is inconclusive, there appears to be faint banding near 2 kb. Will attempt to gel extract from 2 kb region of 2 lane gel.
Gel Extraction of pAOX-OriT and Vector 2 Gibson Components (Stephen)
Loaded 35 uL of the following samples: pAOX-OriT Overlap, V2_1_5, and V2_2_3.
Gel setup:
ladder, V2_1_5, V2_2_3, ladder
ladder, pAOX-OriT Overlap
Results:
V2_1_5 (left), V2_2_3 (right)
pAOX-OriT
Gel extracted bands that were consistent with V2_1_5 and pAOX-OriT. Also extracted region in which V2_2_3 would presumably be found.
PCR of V2_1_5, V2_2_3 and pAOX-OriT (Stephen)
5X Phusion buffer 10 uL
dNTP 1.5 uL
Forward primer 1 uL
Reverse primer 1 uL
Template 1 uL
Phusion 0.5 uL
ddH2O 35 uL
Added primers:
V2_1_5:
V2_5F (A09) 1 uL
V2_1R (A02) 1 uL V2_2_3: V2_2F (A03) V2_3R (A06) pAOX-OriT: pAOX-OriT F B9 pAOX-OriT R B10 |
8/15/2013
Checked control plates from 8/14/2013.
Results:
Plate | Growth |
LB - pUCBB | High |
LB - pSRCK | High |
30 ug/mL G418 - pUCBB | None |
30 ug/mL G418 - pSRCK | High |
200 ug/mL G418 - pUCBB | Almost none |
200 ug/mL G418 - pSRCK | Almost none |
Gel Verification of V2_1_5, V2_2_3, and pAOX-OriT (Stephen)
Gel setup:
Ladder, blank, pAOX-OriT, blank, V2_1_5, blank, V2_2_3, Ladder
Results:
Gel shows banding far below the expected size of the samples. Will redo the PCR overlap of pAOX-OriT, as well as the PCR overlap of V2_2_3. Performing another gel verification on V2_1_5 overlap gel purification product, and V2_1_5 post-gel purification amplification product.
Gradient Overlap PCR V2_2_3 (Stephen)
Reaction 2 V2_2 and V2_3
5X Phusion buffer 10 uL
dNTP 1.5 uL
V2_2 1 uL
V2_3 1 uL
Phusion 0.5 uL
ddH2O 34 uL
Added primers:
V2_2F (A03) V2_3R (A06) Prepared 12 of the above reactions and performed temperature gradient overlap PCR. |
Gel Verification of V2_1_5 Gel Purification Product, and Post-gel Purification PCR Amplification Product from 8/14/2013 (Stephen)
Gel setup:
Ladder, Gel purified V2_1_5, blank, Post-gel purification PCR, blank, blank, blank, blank, blank
20 min. @ 120V
Results:
Gel Verification of Gradient PCR Overlap of V2_2_3 (Stephen)
Gel setup:
Ladder, 1,2,3,4,5,6,7
Ladder, 8,9,10,11,12,blank, blank
Results:
Inconclusive - Expected banding at 2kb. There appears to be a faint band at roughly 2kb, however the banding is indistinct.
08/19/2013
Overlap of WtrFrsh had been sitting for too long. Performing WtrFrsh overlap PCR.
Overlap PCR of WtrFrsh1 WtrFrsh2 (Stephen)
5X Phusion buffer 10 uL
dNTP 1.5 uL
WtrFrsh-1 2 uL
WtrFrsh-2 4 uL
Phusion 0.5 uL
ddH2O 31 uL
Ran overlap PCR program 15 min. During 4oC pause, added 1 uL WtrFrsh F and 1 uL WtrFrsh R primers.
Gel Verification of Vector2 Digest From Single Colony 08/19/2013
Gel setup:
Ladder, Vector2 digest, blank, blank, blank, blank, blank, blank
Results:
Banding at roughly 20kb. Expected roughly 4.8kb. Discarded miniprep from 08/19/2013
Gel Verification of WtrFrsh PCR Amplification 08/20/2013
Two PCR reactions were setup to amplify WtrFrsh overlap PCR product.
Gel setup:
Ladder, WtrFrsh amp 1, WtrFrsh amp 2, blank, blank, blank, blank, blank
Results:
Banding was not distinct. Discarded WtrFrsh overlap amplifications. Will need to run extraction gel on WtrFrsh overlap.
Vector 2 Overlap PCR to Reduce Gibson Assembly Components (Stephen)
One overlap PCR reactions was created.
Reaction 2 V2_2 and V2_3
5X Phusion buffer 10 uL
dNTP 1.5 uL
V2_2 1 uL
V2_3 1 uL
Phusion 0.5 uL
ddH2O 34 uL
Added primers:
V2_2F (A03) V2_3R (A06) |
Gel Verification of V2_2_3 Overlap PCR (08/21/2013)
Expect banding at roughly 2kb, consistent with combination of strings V2_2 (1kb) and V2_3 (1kb).
Results:
Indistinct banding - There appears to be a very faint band at roughly 2kb. Will reamplify strings for Vector 2 in an attempt to get a cleaner product for Gibson assembly or for overlap PCR.
Primer working stocks (08/21/2013)
Created 10X working stocks of all primers. Placed in box labeled “iGEM Vectors”.
PCR Amplification of Vector 2 Strings (08/21/2013)
Performed PCR amplification of all Vector 2 strings. Five reactions were prepared:
Phusion 10X buffer 10 uL
Phusion 0.5 uL
Primer F 1 uL
Primer R 1 uL
Template 1 uL
dNTP 1.5 uL
ddH2O 35 uL
PCR Program:
Vector 2 Strings PCR Product Gel Verification (08/21/2013)
Expect banding at roughly 1kb for each of the five samples.
Results:
Banding found at roughly 1 kb as expected. Will perform gel extraction of bands on new gel, followed by column purification.
Gel Extraction of Vector 2 Strings (08/21/2013) (Stephen)
Ran 1% agarose gel with each of the Vector 2 strings.
Gel image:
Cut five bands from gel at roughly the 1 kb mark. Placed each band into its own microcentrifuge tube.
Performed gel extraction following illustra GFX protocol.
Column Purification of Vector 2 Strings (08/21/2013) (Stephen)
Column purified all Vector 2 string samples using illustra GFX kit. Performed wash step twice to maximize purity.
Vector 2 Strings Quantification (08/21/2013) (Stephen)
Sample ID | ng/ul | A260 | A280 | 260/280 | 260/230 |
V2_1 | 19.99 | 0.4 | 0.227 | 1.76 | 0.2 |
V2_2 | 18.45 | 0.369 | 0.209 | 1.77 | 0.25 |
V2_3 | 19.67 | 0.393 | 0.234 | 1.68 | 0.15 |
V2_4 | 19.62 | 0.392 | 0.239 | 1.64 | 0.52 |
V2_5 | 21.32 | 0.426 | 0.246 | 1.73 | 0.54 |
V2_1: 0.03pmols of DNA
V2_2: 0.028pmols of DNA
V2_3: 0.03pmols of DNA
V2_4: 0.03pmols of DNA
V2_5: 0.035pmols of DNA
Preparation of V1_2 Gene Synthesis Fragment (08/26/2013)
Received 5ug of V1_2 DNA. Added 100 uL to V1_2 and incubated for 45 minutes, rehydrating to 50ng/uL.
Amplification of V1_2 (08/26/2013) Stephen
Prepared the following PCR reaction:
5X phusion buffer 10 uL
dNTP 1.5 uL
F primer (V1_2 F) 1 uL
R primer (V1_2 R) 1 uL
V1_2 1 uL
Phusion 0.5 uL
ddH2O 35 uL
Gel Extraction and Column Purification of V1_2 (08/26/2013) Stephen
Gel setup:
Ladder, 30 uL V1_2 PCR product, 25 uL V1_2 PCR product
Ran gel for 20 minutes at 120V.
Results:
Banding at roughly 1 kb is consistent with V1_2 size. Excised bands from gel. Performed illustra GFX gel purification.
Column Purification of all Vector 1 Strings (08/26/2013) Stephen
The issues we have experienced with the overlapping of vector 2 may have been due to a lack of purity in the templates used. Gel purification followed by column purification with two EtOH washes has brought the Vector 2 strings to a consistent concentration and purity. We are performing the same procedure on the Vector 1 templates.
Followed illustra GFX column purification protocol on all Vector 1 strings, however the EtOH wash was performed twice. Will quantify on 08/27/2013.
pAOX-OriT1, pAOX-OriT2, PCSK1-1, PCSK1-2, PCSK1-3 Amplification (08/26/2013) Stephen
Prepared the following PCR reactions:
5X phusion buffer 10 uL
dNTP 1.5 uL
F primer 1 uL
R primer 1 uL
Template 1 uL
Phusion 0.5 uL
ddH2O 35 uL
Templates:
(1) pAOX-OriT1, (2) pAOX-OriT2, (3) PCSK1-1, (4) PCSK1-2, (5) PCSK1-3
Primers:
(1) pAOX-OriT F, pAOX-OriT1 OE R
(2) pAOX-OriT1 OE F, pAOX-OriT R
(3) PCSK1-1 F, PCSK1-1 R
(4) PCSK1-2 F, PCSK1-2 R
(5) PCSK1-3 F, PCSK1-3 R
Program:
The initial program was erroneously set for site-specific mutagenesis, with a 6 minute extension. The program was halted after ten cycles, and set to a lowe
PCR Program
98 C 02 min
98 C 10 sec
50 C 30 sec
72 C 45 sec
72 C 10 min
04 C hold
Gel Purification and Column Purification of pAOX-OriT1, pAOX-OriT2, PCSK1-1, PCSK1-2, PCSK1-3 (08/26/2013) Stephen
Gel setup: pAOX-OriT1, pAOX-OriT2, PCSK1-1, PCSK1-2, PCSK1-3
Expected banding: pAOX-OriT1 (bp), pAOX-OriT2 (bp), PCSK1-1 (bp), PCSK1-2 (bp), PCSK1-3 (bp)
Results:
Banding is consistent with expected results.
Performed illustra GFX gel purification.
Performed illustra GFX column purification, with two EtOH washes.
Quantify purified products on 08/27/2013.
Quantification of Amplification Products from 08/26/2013 (08/27/2013) Stephen
Sample ID | Nucleic Acid Conc. | Unit | pmols | 260/280 | 260/230 |
V1_1 | 51.7 | ng/µl | 0.082 | 1.74 | 0.21 |
V1_2 | 35.1 | ng/µl | 0.053 | 1.84 | 0.06 |
V1_3 | 21.1 | ng/µl | 0.032 | 2.05 | 0.03 |
V1_4 | 56 | ng/µl | 0.017 | 1.77 | 0.09 |
pGAP XbaI -> BglII | 37.3 | ng/µl | 0.083 | 1.89 | 0.08 |
OriT-PARS1 HindIII | 63 | ng/µl | 0.24 | 1.59 | 0.11 |
alpha-sec BglII -> BamHI | 42.2 | ng/µl | 0.23 | 1.83 | 0.16 |
pAOX-OriT_1 | 27 | ng/µl | 0.068 | 1.87 | 0.55 |
pAOX-OriT_2 | 20.4 | ng/µl | 0.055 | 1.85 | 1.49 |
PCSK1-1 | 28 | ng/µl | 0.028 | 1.86 | 0.74 |
PCSK1-2 | 29.1 | ng/µl | 0.059 | 1.93 | 1.52 |
PCSK1-3 | 27.8 | ng/µl | 0.053 | 1.86 | 1.41 |
Concentration and 260/280 look good for all samples. 260/230 is quite low, however we will attempt the overlaps with these samples.
Overlap PCR of Vector 1, Vector 2, pAOX-OriT (08/28/2013) Stephen
Prepared the following reactions, primers were added after 10 cycles:
V1.1.2 overlap:
5X Phusion buffer 10 uL
Phusion 0.5 uL
V1_1
V1_2
dNTP
Primer: V1_1F
Primer: V1_2R
V1.3.4 overlap:
5X Phusion buffer 10 uL
Phusion 0.5 uL
V1_3 1 uL
V1_4 1 uL
dNTP 1.5 uL
Primer: V1_3F
Primer: V1_4R
V2.1.2 overlap:
5X Phusion buffer 10 uL
Phusion 0.5 uL
V2_1
V2_2
dNTP
Primer: V2_1F
Primer: V2_2R
V2.3.4 overlap:
5X Phusion buffer 10 uL
Phusion 0.5 uL
V2_3 1 uL
V2_4 1 uL
dNTP 1.5 uL
Primer: V2_3F 1 uL
Primer: V2_4R 1 uL
Gel Verification of V2 String Amplifications and PCSK1.1.2.3-BB (08/30/2013) Stephen
Results:
Sample | Expected (bp) | Actual (bp) |
V2_1 | 1000 | |
V2_2 | 1000 | |
V2_3 | 1000 | |
V2_4 | 1000 | |
V2_5 | 933 | |
PCSK1.1.2.3 BglII->NotI | 2300 |
PCSK1.1.2.3-BB will need to be reamplified.
Gel Purification of V2 String Amplifications (08/30/2013) Stephen
Gel setup:
Ladder, V2_1, V2_2, V2_3, V2_4, V2_5, blank, blank
Results:
Excised bands for V2_1, V2_2, V2_3, V2_4, V2_5. Performed illustra GFX gel purification and column purification.
Preparation of V1 Liq. Cultures from 08/29 Transformation (09/02/2013) Stephen
Created 25 ug/uL stock zeocin solution by combining 100 uL 4X Zeocin and 300 uL ddH2O.
Added 6 uL of 25 ug/uL zeocin to 10 4 mL LB tubes.
To each tube a single colony was transferred from the transformation plates by pipette tip. Cultures were allowed to shake overnight at 37oC.
Overlap Extension PCR of all V2 Combonations (09/02/2013) Stephen
The following PCR reactions were carried out:
Reaction | Template1 | Template2 | Forward Primer | Reverse Primer | H2O (uL) |
V2.1.2 | V2-1 (2 uL) | V2-2 (2.33 uL) | V2-1_F (1 uL) | V2-2_R (1 uL) | 31.67 |
V2.2.3 | V2-2 (2uL) | V2-3 (2.2 uL) | V2-2_F (1 uL) | V2-3_R (1 uL) | 31.8 |
V2.3.4 | V2-3 (2 uL) | V2-4 (1 uL) | V2-3_F (1 uL) | V2-4_R (1 uL) | 33 |
V2.4.5 | V2-4 (2 uL) | V2-5 (2.6 uL) | V2-4_F (1 uL) | V2-5_R (1 uL) | 31.4 |
V2.5.1 | V2-5 (2 uL) | V2-1 (2.4 uL) | V2-5_F (1 uL) | V2-1_R (1 uL) | 31.6 |
PCR Program:
2min @98
[ 10sec @98 ] \
[ 30sec @50 ] |--- 10x
[ 90sec @72 ] /
hold @4 *add primers
[ 10sec @98 ] \
[ 30sec @50 ] |--- 25x
[ 90sec @72 ] /
10min @72
hold @4
PCR Colony Screen V1 Transformation from 08/30 (09/03/2013) Stephen
Prepared the following PCR reactions:
GoGreen 2X 5 uL
V1-2_F .5 uL
V1-2_R .5 uL
ddH2O 4 uL
10 uL of the above master mix was transferred into 11 PCR tubes.
1 uL of each of the ten V1 liquid cultures from 09/02 was transferred to a corresponding PCR tube. 1 uL of V1-2 was transferred to the final PCR tube as a positive control.
PCR program:
94oC 5:00
---------------
94oC 0:30
50oC 0:30
72oC 1:00
72oC 7:00
----------------^ 30 cycles
4oC hold
Gel results:
All samples were false positives. Positive control showed banding at expected 1 kb.
Gel Verification of V2 Overlaps (09/03/2013)
Gel setup:
Ladder, V2.1.2, V2.2.3, V2.3.4, V2.4.5, V2.5.1, blank, blank
Results:
All samples showed banding as expected (all roughly 2 kb). Select V2.2.3 and V2.4.5 to attempt Gibson. V2.2.3 was gel extracted, and V2.4.5 was column purified.
Gibson Assembly of V2 (09/03/2013)
Gibson Master Mix 3.5 uL
V2.2.3 3 uL
V2.4.5 1.75 uL
V2-1 1.75 uL
ddH2O 1 uL
PCR program:
37oC 5 min
60 min 50oC
Transformed 100 uL chemically competent E. coli C2566 cells.
Pelleted cells after 1 hour recovery. Resuspended in 100 uL LB. Plated entire 100 uL on one LB+G418 plate.
Gibson Assembly of V1 (09/03/2013)
Gibson Master Mix 7 uL
V1.1.2 7 uL
V1.3.4 5.83 uL
ddH2O 0.17 uL
PCR program:
37oC 5 min
60 min 50oC
Transformed 100 uL chemically competent E. coli C2566 cells with 15 uL of the above Gibson.
Transformed 100 uL chemically competent E. coli C2566 cells with 5 uL of the above Gibson.
Pelleted cells after 1 hour recovery. Resuspended in 100 uL LB. Plated 50 uL on one LB+Zeocin (25 uL of 25 ug/mL Zeocin). Remaining 50 uL was used to inoculate liquid cultures (4 mL LB + Zeocin (25 ug/mL).
Quantification of V2 components:
Sample ID | Concentration (ng/uL) | pmols |
V2-1 | 18 | .027 |
V2-3 | 7 | .011 |
V2-4 | 14 | .021 |
V2-2.3 | 15 | .011 |
V2-4.5 | 14 | .011 |
V2 Overlap Extension PCR to Reduce Gibson Fragments (09/04/2013) Stephen
Four OE PCR reactions were setup as follows:
Each reaction:
Phusion 0.5 uL
Phusion 5X buffer 10 uL
V2-1.2.3:
V2-1 1
V2-2.3 2.5
V2-2.3.4:
V2-2.3 2 uL
V2-4 1 uL
V2-3.4.5:
V2-3 2 uL
V2-4.5 2 uL
V2-4.5.1:
V2-4.5 1 uL
V2-1 2.5 uL
PCR Colony Screen V1 Liquid Cultures from 09/04/2013 (09/05/2013) Stephen
Prepared the following 9 PCR reactions:
5 uL Go-Green 2X Master Mix
3 uL ddH2O
.5 V1-3F
.5 V1-3R
To 8 of the PCR tubes, 1 uL of V1 transformation liquid culture was added.
1 uL of V1-3 was added to a control tube.
Results: