Fungal DNA BARCODING PROTOCOL

Sigrid Jakob, last updated October 22 2024

A blend of the highly recommended Counter Culture Lab protocol, Damon Tighe’s quick + dirty protocol, a protocol I found on ResearchGate and the protocol Alan Rockefeller uses here and here (which has a great section on analyzing results at the end). In addition to this written protocol I’ve also created a series of YouTube videos that show these steps (though some of them are out of date, unlike this protocol).

Also check out this very comprehensive lecture by Alan Rockefeller that includes not only the PCR process but sequence analysis, Genbank upload and tree building. Another great resource are Everymanbio’s YouTube videos on at-home sequencing, sending your samples to the lab and interpreting the results. Harte Singer also recently posted some great videos: editing a trace file, analyzing that sequence with BLAST, building a contig from forward and reverse reads using Seqtrace, and saving your contig and checking it with BLAST.

Danny Miller has created a number of great resources: a video explaining DNA sequencing; a video and accompanying document describing how to make genetic trees and a video and accompanying document describing how to analyze DNA sequences. They can all be found here.

Here is my guide to bulk uploading sequences to Genbank.

UPDATE: I’ve made changes to this protocol based on updated practices by Alan Rockefeller and Stephen Russell - all credit goes to them

I’ve found this protocol to work decently well for fresh and dried gilled fungi, jelly fungi, softer polypores, mycelium, soft and hard ascomycetes/pyrenomycetes.

SUPPLIES FOR EXTRACTION AND AMPLIFICATION

(For summary of equipment, supplies and cost see page 8 onward)

HARDWARE (see also page 7 for options and cost)

• Thermal cycler (I use a miniPCR 16 well thermal cycler - but consider using a used industrial thermal cycler like a used Geneamp 9700 thermal cycler or a used Biorad My Cycler, which are cheape and have greater capacity (see page 9 for more info)
• Centrifuge (I use the Gyro centrifuge that came with my miniPCR kit that can be adapted to take 6 1.7ml or up to 16 0.2ml tubes)
• Gel electrophoresis setup (I use the miniPCR one that came with my kit)

Cheaper hardware can be found used on eBay. Some people don’t use a centrifuge and do OK.

• 3 micropipettes: 1-10 µl, 2-20 µl, 20-200 µl (came with my miniPCR kit). Here is a video on how to use a pipette.
• Scale for very small amounts to measure out agar powder
• Regular kitchen scale for weighing TBE buffer which you’ll use to make a gel block

MISC

• Fine tipped permanent marker (to label tubes)
• Pointed tip tweezers WITHOUT RIDGES to cleanly rip small piece of tissue from mushroom
• Waste container (any plastic container)
• Tube rack (many available on eBay or Amazon) - or improvise one
• Glass cup/beaker for boiling agarose and measuring out buffer
• If you’re not using mastermix that already has dye in it: strips of aluminum foil for mixing loading dye and fungal DNA before loading into gel

For eight samples/one strip:

CONSUMABLES

• Lots of 10µl pipette tips and 200µl pipette tips, loose or in boxes (buy 1000 loose in bulk on eBay to refill boxes)
• Two 0.2 ml PCR tubes per sample, as eight-tube strips (MC Lab wants their samples in a strip, GeneWiz doesn’t) - you can get them with attached lids or separate lids, with flat tops or round tops. Doesn’t really matter what you get, except flat tops are easier to write on
• A pair of disposable non-powdered gloves), or you can just spray your hands with rubbing alcohol
• Small spray bottle of isopropyl alcohol to sterilize hands, tweezers etc throughout (drugstore)

EXTRACTION REAGENTS

• Distilled water (drugstore) or molecular grade water Molecular grade water is a lot more expensive.
• 0.5M NaOH - buy as crystals and dissolve. You only have to do this once - this will last you forever. To make 0.5M NaOH, measure out 5g of sodium hydroxide and dissolve it in 250ml of distilled water (or whatever quantity you want, as long as the ratio is 1:50)
• 1M Tris HCl 8.0 ph buffer - this needs to be diluted 1:10. Do prepare this freshly once in a while. Bacteria can grow in older reagents.

Other options

• IBI Scientific offers a solution (X-Amp 50ml)  that turns extraction into a single step (replacing NaoH and Tris buffer)  and can be kept at room temperature. Upfront cost is high ($145 + shipping), but actual cost per sample is under $0.10. Worth it if you plan to extract a lot of samples.

AMPLIFICATION REAGENTS

• Mastermix (the ODIN if you need very small quantities) or suppliers like New England Bio Labs). I use mastermix that already has loading dye in it (Empirical Bioscience - 12.5ml gets you 1000+ reactions). This saves a step during gel electrophoresis later.

• ITS1 and ITS4 primers: You can order ITS1 and ITS4 fungal primers from ODIN if you want to get started with a small quantity. I prefer to order from IDT or GeneWiz where it’s much cheaper and you get much larger quantities and they’re guaranteed to be fresh. I recommend ordering them in dried/flake form, as follows: For IDT, go to this page. Give your primer a name, choose 25 nanomole oligo, add the primer sequence you want in the sequence field (see page 12 for primer sequences), formulation: none, standard desalting. They’ll send you a seemingly empty tube that has a tiny flake of primer it at the bottom and you will resuspend it which means you will add distilled or molecular grade water (1940 µl for ITS1 for a standard 10µl dilution, 3670 µl for ITS4 for a standard 10µl dilution and 2380 µl for ITS1-KYO for a standard 10µl dilution. You will need a larger tube (2ml) tube to store them, frozen at -20C. When adding water to the flake you want to shake the tube to make sure it dissolves. The primers are about $9 per primer plus shipping and last for hundreds and hundreds of reactions.

• There are other primers, eg ITS4-B for basidiomycetes only (good if there might be mold contamination), but you’ll need to get them custom-mixed (GeneWiz or IDTDNA). I’ve recently been using ITS1-F_KYO2 instead of straight ITS1 (TAGAGGAAGTAAAAGTCGTAA, custom order by GeneWiz or IDT). No particular reason except that it works for me.

GEL ELECTROPHORESIS REAGENTS

• Agarose powder - I’m not sure why it got so expensive. Here is another option.
• TBE buffer (miniPCR, came with kit but available elsewhere) - concentrate can stay at room temperature. I’ve been buying buffer in powdered form, with a higher upfront cost but it lasts for many hundreds of rounds of gel electrophoresis
• Gel stain (miniPCR, came with kit, but available elsewhere) - can stay at room temperature
• Loading dye (the ODIN) - keep in freezer (not needed if you use mastermix with dye)

Storing your reagents

A regular household freezer compartment is enough. Note however that many modern household freezers occasionally raise their temperatures to prevent freezer burn. That’s not good for reagents. I highly recommend storing your reagents in an insulated shipping container or some other kind of insulated container with a few small cold packs.

Reagents also don’t like being thawed and frozen multiple times. I notice that reagents sometimes stop working after a few cycles of freezing and thawing. To help with that I ‘aliquot’ (parcel out) reagents into smaller quantities, into smaller tubes so that I’m not freezing and thawing a large tube of mastermix or primer many times over, but only thaw and freeze a smaller tube a few times. I usually aliquot about 3 reactions worth of primers in one PCR tube, and do several strips at a time so I only have to do this once in a while. I aliquot enough mastermix for eight reactions in a single PCR tube, and fill many strips at a time.

PREPARATION

1. Decide which fungi to process
2. Enter fungi into log/spreadsheet to keep track of them
3. (If not using X-Amp) Make dilutions of the NaOH (1:50 from granules) and the TBE buffer (1:10 from stock mixture) - you only need to do this once in a while since this will create enough for many, many sessions
4. Set up centrifuge
5. Set up thermal cycler. If using miniPCR thermal cycler connect thermal cycler to computer with a cable or download miniPCR app and pair via Bluetooth, create programs for amplification and 10 minute heat block (you’ll only need to do this once) - see later on how to do this
6. Clean area
7. Lay fungi out on a plate in the order of the spreadsheet (I order them by iNat number)
8. Put on gloves or clean hands with isopropyl alcohol
9. Have small glass or sprayer with isopropyl alcohol handy to disinfect hands ever so often
10. Label tube strips (for eight samples you will need two eight-tube strips)

EXTRACTION

• Rip off a bit of tissue from the specimen with tweezers (smaller is better, size of a sesame seed is ideal) and place each in an 0.2ml tube in your tube strip. If specimen is not clean, break it open and take tissue from inside. Make sure to sterilize your tweezers between each specimen by wiping them down with a paper towel with isopropyl alcohol on it.

Newsflash: Harte Singer recently published a new extraction protocol with the following description: “If you want to make the cheapest and most reliable DNA extraction buffer for quick and dirty fungal extraction -> PCR here is the protocol that I have used. I have an overall success rate close to 95% using it. It can be used with fresh or dried tissue, and makes the DNA stable for long periods of time. You could field-sample into it and store at room temperature for weeks, probably months, before heating and diluting. Thanks to Stephen Russell who transcribed the original protocol that this was derived from.” It requires a filter and additional reagents. I haven’t tried it myself yet but it should be good.

The traditional way

• Add 30µl 0.5M NaOH to each tube (no need to switch pipette tips between tubes if you don’t touch the fungal tissue)
• Grind and macerate each sample with a pipette tip for a few seconds - one fresh tip per sample
• Allow to stand for 10 mins (put dried fungi back in bags while you’re waiting)
• Add 150µl of diluted Tris 8.0ph buffer to each tube (no need to switch pipette tips between samples as long as you don’t touch the liquid in the tubes with your pipette tip)
• Heat the tube strip at 95˚ Celsius in your thermal cycler for 10 minutes (so-called “heat block”)

The X-Amp way

• Drop tiny pieces of tissue into separate tubes, wiping tweezers with isopropyl alcohol between samples
• Add 35µl of X-Amp to each tube (careful, it’s drippy)
• Put into thermal cycler for 15-30 minutes at 80C

For both methods

• Centrifuge for 5 mins at 5,000 rpm or higher. Make sure the centrifuge is balanced ie same number of samples on each side, centered. If you’re doing eight samples this means cutting the strip in half. Make sure the tops are properly closed!

AMPLIFICATION

Combine in a loose 0.2ml tube the following reagents, which are enough for eight samples. Do this step quickly. Reagents will start reacting with each other the moment you mix them, and you’ll want to get them into the thermal cycler quickly.

IF YOU’RE DOING A FORWARD READ ONLY

• 95µl of mastermix (enough for eight samples)
• 5µl of forward primer (enough for eight samples)
• 5µl of reverse primer (enough for eight samples)
• 85µl of distilled or molecular grade water (enough for eight samples)

IF YOU’RE DOING A FORWARD AND REVERSE READ

• 110µl of mastermix (for 8 samples)
• 7µl of forward primer (ITS1) (for 8 samples)
• 7µl of reverse primer (ITS4) (for 8 samples)
• 100µl of distilled or molecular grade water or distilled water (for 8 samples)

You’ll need a larger tube since these liquids won’t fit into a regular PCR tube

Mix the mixture by aspirating it up and down the pipette tip when you add the water.

Pipette 19µl (if you’re only doing a forward read) or 26µl (if you’re doing a forward and reverse read) of the mix into each of the tubes of one strip.

Add 1µl of the mushroom liquid you’ve prepared in the extraction step to each of these tubes (2µl if you have used X-Amp), using a new pipette tip for every sample. This is a very small amount. Make sure you’ve actually picked up liquid by visually inspecting the pipette tip.

Pipette up and down a bit to mix. Close tops and flick each tube to ensure it’s all mixed well

Put tubes into thermal cycler

Updated run times per updated Alan Rockefeller/CounterCulture Lab protocol

If you haven’t already programmed your thermal cycler program it now:

Initial denaturation: 2 minutes at 95C

30 cycles of the following:

• Denaturation: 30s at 95C
• Annealing: 30s at 54C for regular ITS1, 52C for ITS1-KYO2
• Extension 55s at 72C

Final extension 120s at 72C

Let it run until the program is done. The samples can sit at room temperature.

GEL ELECTROPHORESIS

EQUIPMENT

Scale for very small amounts with mini container and scoop, for weighing out agarose powder

Regular kitchen scale to weigh TBE buffer to make gel, and to pour over gel

Microwaveable glass cup/beaker for boiling agar and TBE buffer

REAGENTS

Agarose 

TBE buffer (25.5 g makes 3 litres of buffer) or from buffer in powdered form (dilute 3 grams of powder with distilled water to make 415ml)

Gel stain regular (2 μl per gel) or SeeGreen gel stain (1 μl per gel)

Loading dye (the ODIN) unless you’re using a mastermix that already has loading dye in it

MiniPCR have created a video about how to cast a gel

I usually mix for a 1% gel percentage, ie 0.2 grams of agarose and 20ml of TBE

If you’re using SeeGreen gel stain you only need 1µl

If you’re using loading dye, ie if you’re not using a mastermix that already has loading dye in it

Set a small sheet of foil in front of the gel box and pipette 3µL of loading dye onto the foil for each of the samples you want to put through the gel

Add 4µL of your PCR mix to each drop for each sample, using a new pipette tip for each one

If you’re using mastermix that has loading dye in it, simply place 5µm of each sample in a separate well.

Wait a few minutes

Put black cover over the orange cover. Switch on blue light (left button). You should see a band on each lane after a few minutes. Photographing through the hole with your smartphone can help you see better. If you don’t see a band even after waiting for a few minutes the PCR didn’t work for that sample.

Once you know you have a good sample, pipette your PCR mix into numbered tubes in a tube strip and prepare for shipment. You can store it in the fridge for a day or two.

TROUBLESHOOTING AT THE GEL ELECTROPHORESIS STAGE

No bands across the board?

You made a mistake mixing the reagents, perhaps forgetting a primer, or adding the same primer twice instead of one each; you used a much smaller quantity of primer by mistake

You forgot to add loading dye

Your thermal cycler didn’t work

You forgot to add the sample to the mastermix and primers

You forgot to add a stain to the agarose

One of your reagents is too old

Very weak bands across the board?

You didn’t add enough stain to the agarose

You forgot to flick the tubes before putting them in the thermal cycler

No bands in some lanes?

The DNA didn’t amplify, eg because the specimen had issues

You didn’t flick the tubes before putting them in the thermal cycler

You didn’t grind the sample enough (eg hard fruitbodies)

WHICH LAB TO USE FOR SANGER SEQUENCING?

As a non-professional your options are limited. GeneWiz for example wants you to be affiliated with an institution. You could try and make that institution your local mushroom club, if you’re a member. That worked for me, though it took a couple of phone calls with customer service. They’re more expensive but they’ll re-run sequences for you and you can call them to troubleshoot.

MCLab

Molecular Cloning Lab, or MCLab, the lab that I use, put up no such barriers. They’re a lot cheaper and they’re very quick. I’ve never used their customer service but I assume it’s bare bones. They’re based in South San Francisco. If I mail my samples priority mail on a Monday, they’ll often arrive on Wednesday, and results are posted early in the morning on Thursday.

Label as per MC Lab specifications: A01, B01, C01 etc. They want at least 10 microliters for a forward read, and an additional 10 microliters for reverse read - if you are doing a reverse read.

[UPDATE: they apparently now let you submit a single tube for forward and reverse reads)

I usually just do a forward read.

If you’re using ITS1 and or ITS 4, you no longer need to send a primer sample. They have them in stock. Just specify the primer you want used on your order form. If you’re using non-standard primers they will still want a sample of it in addition to your regular samples, 3.3 microliters of primer with 6.7 microliters of distilled water.

Email me at sigridjakob@gmail.com if you need help with their order form - it’s not very newbie-friendly.

MCLab pricing: $1.99 for a forward read + $1 for cleanup (recommended); double that if you want a forward and reverse read.

GeneWiz

You want “Sanger Sequencing PCR Product - Un-Purified”  They have primers so you don’t need to submit yours. They’ll want a picture of your gel as part of the ordering process.

GeneWiz pricing: $9 per sample (last time I checked, they don’t give the price on their website). They’ll automatically do a forward and reverse read and cleanup.

NOTE:

Even if gel electrophoresis signaled that DNA was amplified does not guarantee a good sequence from the lab. Expect some sequences to fail at this stage.

Many things can go wrong. The most common is a contaminated specimen which will result in two sequences on top of each other.

Another common cause of failure is using old reagents, or reagents that have been thawed and frozen too many times.

HOW MUCH WILL THE EQUIPMENT AND REAGENTS COST?

I have not researched new equipment beyond miniPCR, so you will have to do your own research.

eBay is a good source for everything, whether used or new. The Odin sometimes has refurbished equipment, plus some new equipment

ACTUAL COST PER REACTION (as of end of 2024)

So what does it cost to do your own PCR, not factoring in the cost of the hardware?

I’ve calculated the cost of reagents, ‘consumables’ (ie pipette tips and tubes), shipping and Sanger sequencing for one sample, forward read only, using MCLab, assuming 16 samples are shipped at any one time. It comes out at $5.27 per sample including first class shipping

*If you use loading dye

**I buy my master mix in bulk, and it only costs me $0.20 per reaction, but I realize not everyone will spend $200 for 1000 reactions

Primer sequences

Other extraction protocols

PROTOCOLS

Osmundson protocol

Add 100 μL of 0.5 M NaOH to dried tissue

Grind

Heat  to 95C for 10 mins

Centrifuge at 14000 RPM for 2 min

Add 2 μL of the supernatant to 200 μL of 100 mM Tris-HCl, buffered with NaOH to pH 8.5–8.9

Cooper protocol

Vigorously homogenize 20mg of dry sample in 100µm of 0.5M NaOH with a pestle

Heat to 95C for 10 mins

Centrifuge at 14000 rpm for 2 mins

Add 5µl of supernatant to 195uL of 100mM Tris-HCl at pH 8.0

DSMO addition

For every tube replace 1µm of water with 1µm of DMSO (make sure not to get it onto your hands)

Counterculture labs protocol (Alan Rockefeller)

Extraction Solution (ES)

Add 10 ml of 1 M Tris stock (pH=8.0) into clean 100 ml vessel

Add 1.86 g KCl

Add 0.37 g EDTA

Add 80 ml DI or ultrapure H2O and shake until solutes dissolve

Titrate with 1 M NaOH to pH ~ 9.5-10.0

Top up to 100 ml with DI H2O

Filter sterilize into sterile 2 ml Eppendorf tubes

Dilution Solution (BSA 3%)

Add 3 g of BSA into clean vessel

Top up to 100 ml with DI H2O

Shake

Filter sterilize into Eppendorf tubes

Procedure

Pipette out 20 µl of Extraction Solution into 8-strip tubes

Place tissue sample into Extraction Solution. Submerge sample and grind

Incubate at room temp for 10+ minutes then incubate for 10 minutes at 95˚ C.

Add an equal volume of Dilution Solution to each tube

Any questions at all, just email me - sigridjakob@gmail.com